Transcript Name :
Phyra_g16
Orientation:
(-)
Number of Exons:
2
Description :
hypothetical protein, variant
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal16.219PS50244
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-9
10-29
30-63
64-86
87-105
106-128
129-161
162-184
185-220
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
integral component of membraneGO:0016021IEA
cytoplasmGO:0005737IEA
lipid metabolic processGO:0006629IEA
*** None ***
*** None ***
Sequence
        946 bases(100 bases per row)
TGATGTTCATTGGGATGCTGGAGCTGTGGCAGCTCACGTGGGTTATCGCAGTGGCTGGTGCTCTGCTGTCGTTTCGCAGTGGAGCATGTCGGGGCTTCGT
TCTGCAGGGCAAGATGCGCACCCCCGTGGCCGTCGCGCAACTCCCCGGACTATCATTGCTGCGCGTGGAGGTGCCAAAGAGTTACTGGACGTGGTTCTAC
CTCATCGGAGCACTACACAGCATGTTTGGTGCTGGTTGTTGCAGTCTTTTGGCACGACACGCGAGTGGCGCAATTCGCTCTGCACCTTGCGCACCCGAGA
GCGGACCAAGACACTTTGGTGGTGGTCCAGCCGCATACCATTACGTTTCTGGGACTCTTTGCGGTGCACACGACACGGCGCTTCTTGGAATCTCTCCTGA
TGACGGAGTTCGGTGATGCCAAGATGCATGCGTGCAGTATGTTGCTGTAGTTCTCGTCTCGCTTGACGATGCACTAACAGTTTGATGGTGGTGGTGACAG
TTTTGTTTGTAGGCACCTACCACTACGTTGCAACTGTGCTCTCCGTCCTCTTCGACCCGGACGCAATTACGTTGCATGAGAACTCAACGTCGCGCCAAGT
GATGGCTGTGGCTGGAGTTGTAATCTACCTCGTTGCGACCTACCATCAAACGCGCTGCAACTACTTGCTCGCGAAGCAGAAGCGCGCTAACAATATGAAG
CACGTGATTCCCCGTGGTGACTGGTTCGAGACCGTGCGAAGTCCGCTCTACACGACCGAGATCATGCTGTATGGTGGATTTATCCTCGTCACTGGTGGCA
CAGTCTCCATGATCTACCTCATCTCCGCCTGGGTAGTCGCCAACCAGCTTCTCCTCGCACATATCAACTCGCAATGGATCGAGGACAAGTTCCGCGATCG
ACTCCACGAGCTCCCAAAGTGGAAACTCTTTCCACACGTGTGGTGA