Transcript Name :
Phyra_g23
Orientation:
(-)
Number of Exons:
5
Description :
reverse transcriptase, partial
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Reverse transcriptase14.021PS50878
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-334
*** None ***
PositionContextScore
13SWKRFAR|DL0.694
*** None ***
GO
Biological ProcessGO IDPrediction Method
RNA bindingGO:0003723IEA
RNA-dependent DNA replicationGO:0006278IEA
*** None ***
*** None ***
Sequence
        1288 bases(100 bases per row)
TGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGACCTGCACGATGGACGCATCGAGCAGATCTGCATCTTCTCGGACGTCGAGAGGATGACGTG
TGAGCAGAAGAGCTGAAGCAGCTCATCACTGAGGGCGCGGAGACCCTCAGCGCGAAGTCGAAAAGGAACGGTTCGACGAGCAAGGCTGGGACTCGCTCAA
ATCGAGTCCCTTTTACAATGTCTTGCGTGAGTACAAGGATGTACTCCCGGGCGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATT
GATCTCGTGCCGGGAACGAAAGTATTGCGTTACGCGACAGTGACCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAACGTCGTCGCAAG
GCAGGACAAGGGTGGAAATCTAAGTCCCCGCACAGCGCGCCCACGTTATGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCTTACAATAAGC
TAAACGATGCGACGGTACCGGTGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTATTATCTTCAGTACTCTTGATCTGAG
AGACGGGTTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCACAGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAG
GGGCTGAAGAACGCCCCAGCGACATTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGTTATTTCGACGACGTGTTCATTC
ACAGCCGGGCTGTGAATGGGAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGCTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCT
GAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGTGTGATTAAT
GAATGACCTACGCCTTCAAACGTAAAGGAGCTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGAGCAAGATTCGCC
CGCTGTCGGAGCTCTTGAAGAAAGAAGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCATTTGAAGCAGTCAAGCAGGGCTTGGCTGAGGCGATCTT
GGCGTTAGCCGACCAAGATCGCCCATTCCACGTTGTGTGTGCCGCGTCCAATTTCGCGATCGGATTCACACTGATGCAAAGGTCGTGA