Transcript Name :
Phyra_g24
Orientation:
(-)
Number of Exons:
3
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-132
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        4571 bases(100 bases per row)
TGCTAAAGTATCGGATACATAAAGACCCAGTGAAGGTCGCCATGTTGCCTGGCATGCTGGACAAGCTCACGGTGATCGAAAAAACCAAGATCGAGAAGCA
GGGCATCGGATGGGTCAAGAACGCTATTAACGAGCGGTGTGAGAAAGACAACATCATCTACGCAAGCACTAAGTGGGTATCATTCTGGAAATACTTCGAG
CACACATGGCTGACCGAAGTAGTGGAATGTTCATGACTTTAGCAATGGCTTTGTCGCGCGCTCTGTAAGCCACGACCCAGACGAGCTGCTATGCAAGGTG
CAGACTGGCAAGTTTACAAGTAGCTGCATCATCTACGACAACGGAATACCTACCGATGTTTTTTTCCTCGGGGGTTGCGCGTATTCAAACTGTCTTCACT
ATGTCACAACGTTTGAGATGACCAAAGTGATGCATAAAGGCCGGCATTAAGTTCCCGAATCGGAATTCGCTACAGAGTGGAGCAAGCTTTTGACATTCTT
AAAGGAAGGTTTCGTATTCTTCAGAGTGAGATTCCCCGCGCTGTGATGACCTTCGAATTCAACCCAAAGTTGATTTTTGTACTCTGTTTGCTACGCAACT
TCATCATTATAGAAAGCGATTTGTACTACAACCAGTTTGATGTGCAGCGTGAAATTGCAGGTAACCCATATTAGGCACTTCGAAGGGTTTCTGATTAATC
TGTGGGGACGTCGCGCAATGTCTGAATTTGGTTCAGCAACAACAAAAGAAGAGTTAATCACGCTGTCCAAGCCGCTCCCGTAGCAGATCCTGGTTTTCTC
TCTAACGTACTTGGTACTCGCGACACTCCTGGCGCTCATAAACGCGTTGGTGCTGAGCGGCACGGCGATCCTCCAGTATTTCATCTAATTTGTTTACCAA
AGAATCTGTCTGTACCTAGACCAAGTTCATAAGGAAACGCTGGTCATTGCTGGGTTGGGATATTTACTTTCGTTTCTTCTGCCCTGTTATTGAAGGCGAT
TTCTGTGACATAGGTGCATGCTTGTACGGGATCATGATAGAGGCCGCGTTTATGGATACGTTTTTCTGTGTCGAACGCTCTATCTGGTGTCAGGTCTGCT
ATCTGGAGGAAAAATGACCTTTCTTGATGGTGCAAGCGAGGCGTAAATTATGCGCTTGACAATCAAGCAATGGAAATTGCTACCTAACATCCTTGCCTCA
CGAAGCAATGAGAACCCTGGCCGGTTTTGAACCCAGGCGCGGTGAGGTTTGCTTCCCAGATCTGCTGTCGAGCTGCCGCAGACGCTGCAACCGCAAATTT
CCCCTGGTGTGGAGAGTTGGCAGTCGAAATTTGCTAGTGAAGAGTGCGGACAATCTATAGCAGGAGGTGGCCTCGCCGAATTGTTGGTGTATCTGTGCAA
AGTAATCCTGCAGAATGCAGTTATACTAAAGAACGAACTACCGAGTCACCCAATATGGCGCCATTCAGTTTTCCAGTGTGACGAATTTTACCAGTTCAAG
CGTGAGTTGAACGAGTTACTTGGTACTATAGTGGCCCCGACAGAACGGCAGCTGGAGAAAGCTATGCCTGTCGCGTCAAAACAACACTTGATGGTATGCA
TCAGGGTCTGAAAATGTCGGTTGAGAGAATTCGGAACAGTTTGGGGCGTGTCGGCGGAACTTAACCGACATTGCTAAAGTGTTGTCTCCATTTACTGACG
GGACGGCACTGCTGCTAAGATCGTTAGGGGTGATGTGTCTGCAAGACCAACCGCAGTAATACCATTAGCACAAGATATAACGAGACCATCGTACGAAATG
GGGCATGAAGGCGTGGTTCCGTGGCTCCGTGTCGACGGAGTCGCAATGTTATGACTGTCCGAGAGTTGTGGAATGAATGGGAGAAAGGTCTTTCAGGCGG
ACGGTTCGTAAAGACATTGGAAAAGAACTTTGGAGCTAAATTGTGTGGCAACGGAGAAGGCGGTTCTTCAATCACTGTCAAAAACCATCAACGCTGTGAC
GGTCACAACAGAATCAGTACTGAACAGCGGATCCATTGATAGCCACAAGGTTGATGACGTCGCAGTAGAGCATGTGGACGCTGTCAGAAATGCACACAGT
AAAATCGCTGAACTGGTTGTCGCTCAATGCAGATGCAGAAGCAAGGGAGCTAGGGAGCTAGGGATTAATGCACTCATTTACCCCGTACGACCCAGCAGTA
CAGCATCGCGGGCACTGCCATTCAGATAGCTCCGATAACCAATTCTTGAGATATATTGAAAGCTGAATGAAGAATGGAAACGCTCCTATTTCGCCCAGCA
TTTTTAATTTGATCGACCGTCTGTTAGGCCACGGAATGGGCGAGAACCGGTCGATCGAAGACGCAACAGCAGTGTCACGAGATGTTGCGGGCTGTATGCA
ATCTGCAGCAACGATGTGTGATGTTGGCTCAGGCTCTTCGTCGACGGTAGCGTCAAATTCGCCGGTACCAGGAGTTTCCGTAGAGATCGATAAATAAGCA
GCAAAAAAAAACACCGTTCCTACACGCGCCGTTCACGCCGTTCTTTTATAGCCTCTTCAACTCCCGGTAGCGATAGCTACTGTGCAGCAAACAAGGCTAA
CCCTGACCAATCGTATCGACCATTTTTTGAGTCTCGAAATGCATTCTTTCTCTTTTGGTGGCGTCCTTTCCGGGACTTCTTCACATGATAGCCGTGCACG
CGTTGCTTGGGTAGGTGAGGTCGTTCGCGTTGCTGTACATAGGGCTCAACTGCGAGAAACGCATCCGCTACATCAGCTGGTGCTAGAGAGTTGTCGTTGG
TACTAACACCCGTATCTGCGACAGCCGGTACCACCACTCCACACGCAGAGACAGATCTATTGAAGGCGACGTCACTTCCATTGTTTTTGTTTATCACTAT
ATTCATCATTGGACGGCTCGTCCAAGCTGTACAGCAGCCTATCCATGCGTACAGCTTGTGCACAGCTCGCACGCTGTCTTCGACAACGATGCACAGACTT
GTGTTGAGCCGTCCAGCAATAGTACGCCCGCTAACTTCGCTCTGGATGAACGTAAAAAGTTGTCAGCTTCCTCTACCACGAGCCATTCATGTAGCGTGGT
AAAGCCGATTCACCTCGTACCTTAGTGCAACACGCACTAATGAATATATACAGGCTGACCACTCCACAGAGTGGTCCACATTCATAGCAAAGAGATATGA
CTGGTAGAAAGCAACATCTTTCTACCAATGAGAGTCATTCATTAGATAGGGTTCTGCCATCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTT
AGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTGGCACCAAAGCTATCGTTCGGTTCCTTTATCTAGGTTTAAGTATACTTGTGGATACAAGTA
GACTGGATCTAAGGTAAATACTCCTACGCTTCCTCATACACGTGCGCACACGTGTAAGCTAAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCA
CTTTGTAGCCCGTCCAACGACCGACTAAGAACACGTTCGTATGGAATACGAACGCGGGGTTGAGAACGCACCCTCGGACAGTAACATGTTCGTGGGTAGC
CCAAACACGTCTGAAACGCATGTTGCGCGTGCAGACTGCCCCCACCTATCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCGACGGTCATTGGAGAAG
CAGCGGTAGCAACGATGTTGTGTACGCTATCACCGACGGAGCAACACGATGTTGTTCTGGGTTTCATCGTGAAGGAGCAGCGTGAAACCACTGCTCGAGC
TTCGGTGTCGCCTTCGGCCACACCGCGCGTGGAGTCATTGACACTCCACGTAAGCAGCTATGTTGGAAGAGAGGGGGAACCTCTCTTCCGTTGGCTTGTC
GAGGCCGACACTGTCATTACTGCTCGACGTATCGTCGACCTGTTGTCGAGGGTTGCGTTCGCCATGTCATGTCTTGACGGACGAGCAAGGAGTTGGGCGT
ACGAACGCCGACTCACAGACCCTACGTGCTTCAGCGCGTACGAGGTGTTCAAGGAGGAGCTCAAACAAGCGTTTGAGCCCCCGCAGAACGAGTTCCGATC
GAGGGCAGAGTTCCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGGACAAAGAGCACGATACTTGGTCTCGAACATCGTGACCAACCCGATC
GACGAGGCGACAAAGGTCGTCACGTTCATGAAAGGCCTTAGAGATGGGCCTATGAAGACTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAAT
TGGGCTCGCAATACAAGAAGAGTTTAGCCTGCGAGGCTAAACTGCATGTGAGCGTCCCGCGGCTGATGCCACGACCGGTGGTAAGGCCGTCGGGAGGACC
GGAACCAATTAACCTCTCGGGTGCGACGGCTGCTGGTTCCCAGCAGCGTCATGGATCAACAATGTTCATTGTTTCCGCTGCGGACACATCGGTCACTACG
CCCGCGAGGGCACAGCACCTGTGCGCGCGACCAGGAGCCGCGTGGCGATACTGGGTATCGTCACAGGCTAA