Transcript Name :
Phyra_g15
Orientation:
(+)
Number of Exons:
10
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
ABC transporter-like19.141PS50893
ABC transporter-like17.12PS50893
HmmSmart predictionP-Valprediction_id
AAA+ ATPase domain0.000000000018SM00382
AAA+ ATPase domain0.0000037SM00382
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-130
131-153
154-189
190-212
213-242
243-265
266-284
285-307
308-321
322-344
345-350
351-368
369-491
492-514
515-813
814-836
837-936
937-959
960-990
991-1013
1014-1022
1023-1045
1046-1057
1058-1080
1081-1094
1095-1117
1118-1170
1171-1193
1194-2115
*** None ***
PositionContextScore
188LVLRRRR|PV0.536
2110GKNRPRR|AR0.6
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
ATPase activityGO:0016887IEA
nucleotide bindingGO:0000166IEA
*** None ***
*** None ***
Sequence
        11860 bases(100 bases per row)
ATGGCAGACGCTGGAGGATCGTCGGACGACGCCGAGAGCGCCACCCTCACGGCGCTCTCCGACTGCGTGGCCACCGTCCTGGAGAACGACATCTCCTACG
GACTGTGCGTCACCAACTCGGGGCTCTTCGACCTGGTGCCGTCGCAGCTCCAGGGCAACAATACCAATGCCTCCTCCTCCTCCTCCTCTTCTTCCTCCTC
CAATGAATTCAACGGGGACTCAGTGTGCCGCATCCTGTGTTCCAAACTCTCGACGTCCGCCTCCTCCTCGTGCTGTGACGCGGCCGCCTCGCTCCAGTCC
TGCAACACGACGTCGTCGGCCGTCACGTCCTGCAAAGAGCTCTTTGACAGCGTCTTCACGTACCAGAACGAGTGCGACGGAGGCCTCTCCTCCGCTAATA
CAATATTAATTGCCGTCGTGGTCGTCGTGGTCGCCGTTGCGGCATCCTTCGCGCTGCTCTCGAGATGCTACGGTCGCAGCCAGGGACTTGCAGCCAAAGT
GGCGGCCACCTGCAGACAAATCGCCAATTTGGTGTGGAAGAACTTGGTGCTGCGACGTCGACGTCCCGTGTCGTTGGCCTTGGAGATCTTACTGCCCGTG
CTGTTGGCCTCAGCGCTCTTGGTGCTGGCCAATCTCGACAACTTCGCGGGAGGGTGGAGGGCCTCGTGGTTCACGTCGGAAGCTGCGGTGCTCGACGCGA
ACGAGACGCTCATTTGCAGCGACGTGGTGGTGTGGGGCTCGAGACGATTGGAGGACCGTCGTCCACCATGACATCCTTCTTCTCAGGGGGCAGTCGGTGC
TGGGGCTCTTCTTCTTGGTGAGTTACATCAAGTTTGTGTCCACGACCACGACCACGATGGTCATTGAGAAGGAGAACAGGCTGCGGGAGGTCATGAAGAT
CATGGGACTGTCGGATGCCACGCTGCTCTGCTCCTGGTGTGTCACGACGGCACTGCTGTCGACGCCTTTGGCGTTCGCGATCGCTGCGGAGCTCAAATAC
GGCAACGTGTTCCCCACGACCGAGTACGCGACGCTCGTGTTCCTCTTCTGGACGCTCAGTGTGGCGATCACGGCCTTCTCGTACTTCGTCGCGCCCTTCT
TCAACAAGTCTCGGACGGCGGCTATTGCGTCCGTGTTGCTCTGGCTTATTCTGTTCTTCCCCTACTTCGCAGTGCAGTCCGCTGATACAAATGGACCGAG
ATACTGGGCTGCCTTGGCGCCGCCGACTGCGTTCGCGCTGGCGATAGACGAGATCCTGCGTCGTGCTCAACTCGGGACGGGATTTGCCTATTCTGTCGGC
CTTCGAGAGGAGCCCGTGACAGTGCCAAGCGCCTTCAGATGAGCCTGTTCCTCATTCTCGACTCCGCATTCTTGTGGCGCTGGATGGTACTTGGAGCAGG
TCCTGCCGCAGCAATACGGCATAAGGAAGCCGTGGTACTTCTTGTTCACGAAAAGCTACTGGTTTAATAAGATTGATCACGAACCAGCAAGCGCTGAGGA
GCAACAACTCCGTCGCTGTCTCCTCAAGCAGGTGGAGTCTACACACAGCTTACTGACGGAAAGATCACGGTCCAGACGCTGGAAGTTGAGCCTGGAAATG
CATACGTGGAGCCCGTCAATGCAACGTTGGCAGTGCAAGAACGCAATGGCACCTGCCTACAGATTCGCGGACTGCGAAAAGTGTTCCCGCTCGAAGAAGA
CGGCGAGGAGCACGTGGCTGTTGCTGGATTGGATCTGGCCATGTACAGCGGTCAGATCACTGCTTTGCTCGGACACAATGGAGCTGGCAAGACGACGATC
ATCTCGATGCTGACGGGTCTGATCCCGCCGACGGCAGGAGATGCGACCTTGTACGGGTGCTCCATCAAGCGAGACTTCCACGAGCTGCGGCGCGTGATTG
GTATTTGTCCTCAGCACGACGTGCTGTTTCAGGATCTGACTGTAGAGGAACACATGCTGCTCTTCGGCACGATGAAGCAGGTGCCACGCCACAAACTCCA
GAGCAGCGTGGACAAAATGATTGAGGACGTTGGACTGACGGAGATTCGGAACGCGCTCGCGAAGACGCTCTCAGGCGGTCAAAAGCGCAAGCTCAGTGTT
GCCCTCGCGTTCCTTGGGGGCAGCAAACTGGTGTTTTTGGACGAGCCCACGTCAGGCATGGACCCATACTCTCGGCGTTTCACGTGGAACTTGCTCCAGC
AGAGCCGAGAGGACCGCGTCATTGTCTTGACGACGCACTTCATGGACGAGGCTGACATCCTCGGCGACCGTATCGCAATCCTGGCTGACGGTCAACTGCG
GTGTGCCGGATCATCGCTGTTCCTCAAGAACCGCTTCGGTGCCGGATACAACCTGACAATGATCAAGACTTCGAATGGCTCGTGTGACGTACACTTGGTG
CAAAGCTTTCTCAAGAAGTACGTTCCTGGCGTCAAGTGTCTAAGTAGTTCTGGGTCGGAGCTTGTGTTCCAGTTGCCGACGGCATCGTCAGAGGCGTTTC
CTGCTATGCTCGAGCACCTGGATGCTGAAATGCACGAGCTTGGTGTGCAGCAGTACGGCATTTCGGTGACAACTCTGGAGGAAGTCTTCCTGCGTATTTC
CCAGGACCATGACCAGCAGCAAGAGCAGCACGAAGCAGATGGAGAGGCGTGTCCTCCCTATTGGAGCGAAAACCCTCGGCTTCGGTGGTGGGTCGTACAT
CCCTGAAGCTGGTATCGGCAACAGGTGTGGTGAATTTGCCATCGACTGCTCCACCGATCACCGAGCCTACGATGTGGATGCAGTACGTGGCACTGATGAA
GAAGCGTTTCCAGATTGCCAAGCGTGACAAGAAGACGTTGGCGTACTCGGTGGGTATTCCGCTCATCTTCCTGATCATCCTCGCAATTCTCCCAGAGATC
CAAGTGGCGGACTTCATTCCCAACTACACGTCGAATCTCCCCACGGATGCGCAACAAAGCCAATGCGCTGCGTCAACCAACTTCAGCAGTCTGGTGGACG
CAGATTACAACGTTTCGTCATGCATGAGCTTCCGTGGCTTCGACTACTGCACGCTCGGCGTCATCGACTGCGACGTCAACGTGTGTTGCGATGCGGCCAA
CATCGCCTCGCCATGGTATCCGTGCAACACGTGTGGGTCGTCGCCATGCTACAACAACAACTGCCTCGCGAAGAACAACGCGAAGCTGCAAGTGACACTC
AACGGCTTCTTGATAGCGCTCGTTGTGATGTTGGCATTCGCCTTCATCCCTGCAGCTATCGTGGCGTTTGTCGTCCGTGAGAAAGACCCCATCCAGAACG
CCAAGAGCTTGCAGCTGATCAGTGGCGCCAATGTGTCTGCGTACTGGATGGCGAACTGGACACATGATCTCCTGCTCACGATCATCCCGATTGTGGCTGC
TGCGATTATTATCCCGTTGTCGATGGTACCAAGTGGAGCGGCGAATGCTAGCTCCGCCGATGTGTTTGCCGTCATTGTGCTTGTGATCGCGCACGTCTGG
GCGATTATTCCACTAGCGTATCTGTTTTCGAGGCGGTATGTGAAGCACGCTGTTGCCCAGACGGCGCTGCTCGTGTTCGCCTTGGGCACGGGCGGCTTGC
TGAGTATCTTCTCGTTCATGTGCCGCATCGTCAACTTCACCATCTCGGGCTCTTTGACGCTTTCGTCACTCGACCAGAACTACTTTCGATGGATCTTCAT
GATTTTCCCGGGCTACACGCTGAACAACGGCATCTTCGAGCTGGCCACGCGCAAAGTGAGTCGTCGGGCGATGTTCGGCTCGGCTCGCTGGCTTCAGGCG
TCTCCGTCCTTCTTCGGTCTGTTCGAAGGTTTGGGCAAAGAAGAGTGCATGGAGTGCTGGGACCGAAACGATCCCTCTTGCTGTGTGCGGCAGCCGTTCG
ATTTGGAGATTGTTGGCGCGCCGCTGATGTACACGGTGGTCGAGGCTGTTGTGTTGTCTGTGCTTGTGTTCGTGCTGGAGAACCGATCGGTTCGGTGGAA
CCAGACTGGAGCGAGCCAAGACGAGAAAGCGGTTCATAGCGCGGTTGGTGTGGATGCTGCCGACACAGCGGACGAAGAAGAGGACGACGACGTGCAGCGT
GAGCGACAACGCGTGGAGCATGAGGCTCCGCAGACGAACGATCTTGTGTTCATTCGTAACTTAAGACAGCAGTACGCTGGCAAGCCGCGAGCCAAGGTCG
CACTGAAGGACTTGTGCCTATCCATCCAGAGCGGCGAATGCTTCGGCTACCTTGGTATCAACGGTGCCGGTAAGTCAACTACGATGGCTGTGCTGACAGG
TCAGCTAGCACCCACACAAGGCTTCGTCACTTTGAGCGGGTTCGATCTGTCAACCAGTTCGGCGGCTGCACGGAAGACCATGGGCTACTGCCCTCAGTTT
GACGCACTGCACGACCTGCTGACCGTGAAAGAGCAGCTGGAGTTGTACGCTCGGATCAAGGGCATTCCCGAGGCTTTCGTGAATACCGCAGTGGACGAAC
AGATCCAGGAGCTGGGTCTCTCGAAGTACCGCGACAAGCTCACACAGGGTCTCAGCGGCGGCAACAAACGGAAGGTATCGACGGCCATCGCATTGCTTGG
TCGTCCACGTGTCGTCTTCCTGGATGAGCCGTCGACAGGCGTGGATCCGAGCTCTCGTCGAAAGATGTGGGACGTCATCGCCCGCGTGTGCTCGACTGAC
AAGGATGACAACCGTGATGGCGGCGCCTGTGTCGTCCTTACCACCCACAGCATGGAGGAATGCGAGGCACTTTGCTCTCGAGTGGGCATCCTCGTGAGCG
GGCGACTCAAATGTCTTGGTAGCGTCGAGCACCTCAAACAGAAGTTTGGTCGGGGTTACACTGTGGAAATCACCCTTCGCGCGTTGACAAGCTCAGTGAA
TGCCGATAACACGGAGCTGAAGAGTGTGACGGATCAAGTGCTGGCGTTCCTCTCTGCCGAACGGAGTCTGTCAGCACGTCGCAGTGAGAGAAGCAGTCAA
CGACAGAGCTCAATCAACACCGCCACCAACGGCGGGGCGAAGGTCACGTCCGCCAACATCCAAGAGCTGTGCATAGTCCTCGGTGCTCCAGAACGTGGTA
GTAGCATTTTGGACCACACCGGCACAGGTTGGTTGCTTGGCAGTCAGCTGGAAGCGCAGGGTGCGATCTCCGTCGACAGCTTCTGTTCGTGGTGGGTCTC
CGAAACCCACGGCGAGAAGCTGCAGAAGTTTTTCCACGATAAGTTCCCGGGTAGTGTCCTCGCAGAGCAGCAAGGTGAGCACTTCCGTTTCCAGGTGCCC
AAGCTCCGACCGGATAGCTCCGACGGCAGTGCAGCGTTGCGTCCGGCCGAGATTTTCCGCGCGCTCGAGCACACGCGCTCAGACCTCAACGTGGACGAGT
ACAGCGTGAGTGAAACTGCACTGGAGCACATTTTTAACAACATGGCGGCGCAGCAGGACGAGGAGAAGGGCGTCGCACACGGCATGTATCAGTGATGAGC
AATTGAACCTAAGTAATATTCTCGTTGATTCTTCTCGTCGGATGAACTTGTACTTCATTTTAATGAGTACTGTTGTGAATTACTGGTCCTCACCGGTTGC
TACTGTTGCAGTTTAGCTTTTGTCTTACAGCAAGTTGAAGTGTAGATACACAAAATGCTCAGGAGCTGGGAAAGGAGAGAGAAAAGCAAAGAGGGGGAAA
ACCACACAACAGAAAATACAACGGGAGCAGCACGTCGCTTTACTCCCTCGCCCCGTGTTCGTCTTCTCTTTCTTGTTCGTTGTGCGGTGTGAGTTGCTGA
CGCACGCAAAAGCAGCCAAGTTACAAGTGGTTATGAGCCCAAGGCTGGGTTGGTAACTCCCCGACGGTGAAGATCATGAGTACAAGTGCAGACACGAAGA
AAGAGACGAAGGAAGAGAAAAGGCCGCTCACCCACCGTTCGATGGCAAGGACTTCGAGGTGTGGTTCGAGCGCATGAAGTTGAAGCTGGAACGCAAGGGA
ATGTGGAAGTACTGCGTGAAGGAGATCGAGGAGCCGGAGGAGTCGAAGCAGAACGAGCACGACGCGTGGATGAAGGACTCTGCGCGCGCTAAGGAGCTAC
TCTATGACGGAATGACGGACAAGATAATGAAAACGGTGAAGTTTGAGCCGACTGCGTTCCGTGTAGTGGAGAGACTGAAGCAGAGATTCGTCGGGAAAAC
GTATTTCAAGTATGCAGCGGAGATGACACAGCTGAGGAAGCTCCGACTCCAGGAGAACGGGAATATGCCCGATCATTTGGGTGAAGTGCGAAGATTAATT
GATCGAATTGCTCTATTGGGTAAACCTCTTGATGAGTATGAGAAGCCTGCGATTTTGATCGGCACACTGCCTGACGATTACGATAACGTGGTGGAAACAT
TTCTGGCAAGTCACGTGCCTCGAGATGTAAATGACCCTCCCAACTATGATCAATTGGAGCATGCATTGGAGCTCGCGTATGATCGGCGCCAAGGACGAAA
GCTAAATGAAGGCAACGAAGATCAAGCCTTGTTTGGAGGATCTGGTAGAGGTCGGGGCCGAGGTCGTGGTCGCGGTCGTGGCTCTGATCGTGGCCGCGGT
GGCCGGCAGTGGAGGACGTGGCCGAGGCAGAGGTTTTGGTCGTGGTGGTGGTCGAGGAGGTAGCCAAGGAGCTGGACGCGGACGTGAAGGTCAAGTCACC
AGTAAAGGAAGATGTTTTCATTGCGGAGAGCAATCGCACCAAGTGCGAGACTGCCCGCACTTAGACATCCGCCAAGTGGTGCCCGCGGATCCGAGCCACC
TCAAAAGCAAGCCAAGGTAGAAGGAGCGCAGGGGAAGCGAGCTGCAAAGAACCAGTATACTCAGGATGAGAGTGATGAATCGGCATATGTGGTTAGTGCT
CTCATTAAGCAGCCTCCCAACGTGCAGAAGTTTGCAAGCAAGCGCTGGTACTTGGACTCGGGAGCCACAAGCCATTTGACTAACCAGAAAATTGATTTTA
TTTCGTTCACGGCCATGAGTGCATTGGTGAGAGTTGGTGGTGAGAACTGGTTGAATGTAGCTGGAATTGGCACCGTGAAAAAGGAGATCCAGACTACGAG
TGGGTGGCGGACGTTAGTACTGCGTGGAGTACGCTATGTACCAGAACTGCAATGTAGTTTGTTCTCAGTGCGGCGACAAACCGCACAAACCCTGCCCGCA
GATGAGAAGGTTCGAGTTCACTTTGATGACGATGAATTCGCAAAGGTGAAATTTGAACAAGGAAGTGCGAAGGCACATGTCGACAGAACCAATCTTTATT
GCTTAGAGCTGGAAAGTTCTGTGAACTCCGCATTGGTCGTCGCCACGGATGGAGACTACAAGTGCAGCTGTGGACACGCGCCTTGGTCACCCAGGACGGA
CAATATTCAACGCACTATTTCGACATGCAGATTGGCCGTTGTTAGCTGTGGATCTGAGGATCAGACAAGATTTCAGCTGTGAAGCATGTGTGAGAGGCAA
GATGACGAGAAAGAGTTTTCACTCGGTGCAGAGTTCGAATCGTGACTGGTTAATTGGAGAACGAGCACACGTGGATGTTTGGGGGCCGTATCCAGTGGCG
TCATACTCGGGCATGCGCTACTTTGCTCTCTTCGTCGATGAGGCGTCTCGCTTCTCGACTTTGTTTCTGATGAAAGAGCGCACCAACGTCTACGCAAAGT
TCCAGTTCTACTATGAGCGAGTAAAAACACAATTGAAAATCCGAATGAAAGAGCTTCGTTGTGATAATGCTCGCGAACTACTAGCGCTCGGTGAAAAGTG
CAAACGCACGTACGGAATGGAGTGCTCGCTGACGGTGAAGCATACCCCAGAGCAAAACGGAGTTGCTGAACGAATGATTCGCACGGTGACTGAGAGGATG
AGGTGCTTGCTGGAGCATTTCGGACTGCCCAAGCAGATGTGGGCGGAGGCCGCTGCCACCAGCGTATTGTGTAAACATAGTGCCGAACAAGAGAAAAGGA
ATGCAAGTCCCGTATGCAGTGTGGTTCAGAGAGACACCTGCGTATTCGAGACTTCGGACATTCGGTTGTGCTGTGTTAGCTTACGTTGACAAAGTTGAGC
GCAAGAAAATGGATTCACGAGCAAAAGAAGCTGTATTCGTTGGTTATTCTCGTGAGCGAAGAGGCTATCGGTTGCTGGACAGCAAGACGAACAAGGCGTT
CTACAGCCACACAGCGGTCTTCTATGAAGATAAACCTGGACGAATCCTGTTGAAGGATGGTACAGAGGCACCAACTGTCCCCACGTCGGAGTATTTGGAC
ATTAATGCTACGACGATGCAGAATATCCCAGCTTTGCTGGAGGAAGCTCAAGCTGAGGAGATGCCTGACTCAGAGTGCAGAACTGGTGGGGCTAGTGGAG
GTGCAGTGCCAGCTGAGGTTGCAGATGAAAGTCGTGCACAGCATTAGTGGTGCTTCTCGTGAGACTACTATATCACGAAAAAGAGCGCGAGCGAGTGGCA
TCTCGGCTCCGCGCAAAAGAGTCCGCATAGACGAAAAGGTGGCACCAGGTGCAGAAGCAGCACCGGTGAAGGAAAATGCTCATCGTCAGAAGAAAAGAAA
AAGAGGGAAAAGAAAGAAACCAAGTTGTGAACGGTGCGATACACCAAATGAAGAGTCTGATGGTCCGGGCAGTAGGCGGTGTGCGACACCGGCTGTAGAG
CAAGATGATAAGGAGACTGAAGGGCAGCAATCTTCCACTCGTTTGCCTGGTGCGATAGCGACCACCAGCAACGAGACGCTGGATGCTGATGGTGACTCGC
CGATGGGGGACCTTACCGTCTCTGAGCAGCGAGATGCACCTCGCAGTAAGGCATCGAAGACTGGCTGCAGAGAATACCGGACGAAGAGTGGCCGAGTGTC
GAAGCCACCACGGTGGCTAAGCGACACCATTCATCTTGCATACGGAGACTCAATTGAGAAGAAGAGGTCAGCTGGTTCATCAAGCTGGGAGGTGAAACGT
GATGAAATGCAGTTTGAAATCGCAAAAGAGAAAGCAATGGATTGGTGGCAAGACTTATGTTGTCTTTCGGCCAGTATAATTAATGAACCAGAGACCCTTG
ACGATGCAATGAATAGTGAATACTCAGAGGAGTGGCGATCAGCAGCAGACATCGAGTACCATGCATTGAAGAAAAATGGCACATGGAAGCTGGTCCCTCG
ACGGAAAGGGATGAAGGTGCTCGGAAACCGGTGGATATTTCGTGTAAAGTATCTTCCTAATGGCAAAATTGAGAGGTTCAAAGCCCGACTGGTGGTCAAG
GGCTTTATGCAGGTCTATGGCGTGGACTACCTTGAAGTATACTCACCTGTGGTCCGCTTGGAGACTCTGCGGATGTTGCTGACGCTGGCTGCAATCTGGG
ACTACGAAGTCGACCAGATGGACGTGACGACCGCATTCTTGAATGGCCCTATCGATAGAGAGGTGTACATGGAGCAACCAAAGGGGTACGAGGAAACAGG
AAAAGAGGACTGGGTTTGCATGCTGGATAAAAGCCTGTATGGCTTAAAGCAAGCCCCTCGTGTTTGGTTTCGCCTACTGAAAGACCACCTAGAGAAGCAA
GGCTTTACAATAATGAATTGTGAGGCTTGTGTTGCTGTGAAAGATATTGATGGTGAGCTGTGTTTATCTCCATCTACGTGGATGATTTGATTCTATTCGC
CCCCAACAAGAAGTTGATGAAGGAGCTGAAGCAGATGCTTCACGTGCGTTTCGAGATGAAGGACTTGGGGCCGATTCACTACATCTTGGGCTGGGAGATA
ATGCGGAACAGAATGGAGCGGACAATTTTCATCAACCAGCACAAGTATGCTGACAAAGTATTGCATCGATTTGGAATGGAAAGATGCAATGGCTGCAAAG
TGCCAAGCACTCCTGACTTGAAGCTATCGAAGGTCATGTGTCCGACCACGAAAGAGGAGAAGGGCTTGATGAGTGGAAAGCCGTACCGGGCTGTAATTGG
CAGTCTAATGTACTTGATGTTGGGCACACGCCCTGATTTGGCTTACCTGGTCCGTGAGTGCAGTCAATTTCTCGAGAACCCTGGAATTTTGCACTGGCGC
GCTGCAAAGCGTGGGCTACGTTACTTAAAGGAGACGCAGGACTGGGGCCTACAATTAGGAGGAGTGCAATGGAGTCAGCAGGAATTGAATGATCATCTCA
AAGCTTTTGCAGATGCAGACTTTGCGAACCGAGTGGACGATCGGAAGTCTATTGCTGGGTATCTCACCCAGTTCTGTGGCAGCACCATTTCTTGGGCAAG
CCAGACAGAACGAACGGTCGCTTTGCACACGACAGAAGCAGAGTACATGGCGCTCAGCCTTCTTGTCCAAGAAGTCATACACCTGCGGCAGATGTTGAAA
GAGCTGAAGGTAAAGCAGGACAACCCCTCAGATGTATTTGTGGATAACGAAAGCGCTCGAAAGTTGGCGAACAACCCTGAATTTCACAGTCGGACAAAAC
ACATTGATGTGCGACATCATTTTGTCCGAGAACGTGTTGAGCTGAACGAGATCACTGTGAAACGAGTCGCTGGGACTGACAATGTGGCTGATGCATTCAC
GAAGCCACTACCTCGTGTGAAACTTGAGCAACACCGAGCAAGCATGGGTTTGATTTCCCAAGGGCAATACGAGACTACCAAGAACTTGTGCAACGTTGAC
AACCAGTAGGTGGGGCTGTTGTGAATTACTGGTCCTCACCGGTTGCTACTGTTGCAGTTTAGCTTTTGTCTTACAGCAAGTTGAAGTGTAGATACACAAA
ATGCTCAGGAGCTGGGAAAGGAGAGAGAAAAGCAAAGAGGGGGAAAACCACACAACAGAAAATACAACGGGAGCAGCACGTCGCTTTACTCCCTCGCCCC
GTGTTCGTCTTCTCTTTCTTGTTCGTTGTGCGGTGTGAGTTGCTGACGCACGCAAAAGCAGCCAAGTTACAAGTAGTACAAAGACCGTCTCAAAGAGGGG
GAGACAGTAGAGTACGCCCGTGCTTCCGGCGTTGGTTCCGTCATTGCGATTCCTGAAGTGTGACACATAACGGATACGACTGAGCACAAGTATAACAGGT
TGCTATTTTTCGACATACAAAAAACGAGTCACGCGACGACCCTGTTGCATTTCCGATAGTGTGGGCCATGTCCAAGTGGAGCAAGAAGAACCGCGCGCCC
GCGGGCTACGCGTACATCGAGCCGGTGATGGACGCGCTGGAGCGCGAGCTGCGCGAGAAGATGAACGAGCCGCACGAGGGCAAGCGCCAGTGCGAGGCGC
TGTGGCCCGTGCACAAATCAACTGGCAGCGCAGTCGCTACGTGTTCGACATGTTCCACAAGTACCACAAGATCCCGCGCGAGGTCTACGACTACTGCGTC
AAGCGCAAACTCGTGGACGCCAACCTCATCGCCAAGTGGAAAAAGCCGGGCTACGAGCGATTGTGCAGCACCTTTGCTATTAACCCAAAGAACTACAACT
ACGGCACCGTCAGCATCTGCCGCGTGCCGAGGCAGCAGCTCTCGGAGGGGCAGGCGGTGCAGGAGAAGCACAGCGGCTGCAGAGGGTGCGCGTCTGGACC
CGGAGGGTACCACAACATCTTTGGCAACAAGTACGGGCAGTACCTGGCCCGGATTCAGATCGCCAGGGAAGACGCAGCCAAGGATGTGAAGCAGATCTGG
GCCACGGAGGAGGACGAAGACGGGAGTGGAGAGGAAGATAAGAAGAGAAGAGGCAAGAACCGACCCAGGAGAGCGAGAGTGAGGAGAGTGAGGACAGCGA
GAGTGAAGAGGAAGAGACCAAGGAGTCTGAACCCCCATCCAAGATGCAGAAGGCGGAGTG