Transcript Name :
Phyra_g4656
Orientation:
(-)
Number of Exons:
5
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Helicase, C-terminal11.709PS51194
HmmSmart predictionP-Valprediction_id
Helicase, C-terminal6.8e-16SM00490
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-589
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
nucleic acid bindingGO:0003676IEA
helicase activityGO:0004386IEA
*** None ***
*** None ***
Sequence
        6212 bases(100 bases per row)
TGACGACCTCCAGCACCGTCTCGTTGCCCAGCGTGCGCCAGCCAGAGCCGCCCCTGGGGCGCGCAGCCGCCGACCAGCGCCGCCGCTCGGTGCCCAAGAT
CACTGGCCGCAAGCTGCGCACGCCGCGCAAATTCGTAGTCACAGACGTGCCCGAGGACGAGCTGGACGTGCTCACGCCCAGCGCGTCGCTCAGCGCCATG
TCGGACGCGTCGGAGCAGCCGCGAGACGACGACAACAACAACTGCGAAGACCTATCGGCCTCCAGCTCTTCCGTGCGCAAGGGCAAGACGCAGGTCCGAG
GCCGATTCACCATCACCGACCTGTCGCCAGAGTCCCCTGAGCGCGAAGACTGTCGGTGTCCATGGGGCCCACGACCTCGCGTGTCCTGGAGGCCCCTCGA
CGGCAGACAGCCAGGAAATTAGCTAGCCGGAGACCGTTCCAGTCGGCGGGCGACGTCCGCTCGTCTGTTGGCCTTACGAAGCAACGCCTTTCTCTACAGC
AACAGCAGCTGCAGCAGCAGGAGTCGCCCGTGTTCGCAGCTTTCCAGCGGTCGGCATCGTCACCTTCGTCCCGTTCCATGCGTGCTCCGTCGCCAGCTCG
ACCGGTGAACAACCAAAGTAGCCACAACAACCAAAGCCAAACAGTGTTCGACCACCACTTGGAGTTCCTCGAGAAGGAGACCCAGGAGATGAAGTCGGTG
CTCGAGAAGATGGTGACTACCAATGCTCAGTGGATTGAAGCCCTTACACTGCTGGACTTGTTAGCGCTCCTAGATTGAGCGACGTTTCTGTTTCAGAACC
TGTTGCTCCCGTAGAGACGCCTCTGGAGGAGAAGTACCACGAGGTCGAGAAAGCGTACGCGGAGCTGCAGGTGAAGTACGAGGCTGTGTGCCAAAAGAGC
GAACGCCTTGATGTGAAGAACGCCATGTTGGAGATTCGTCTCCAACAGCAAATTAACCGCTCGACAATGCTGCGATCGCAGCTTGACAATCTGACGCAGT
ACACGGAGAAACTGATTGGCGCGTCTTCGGAGCCTACTCTGCATGACTACAACTCGGACGTTAACTCTATCTTTGGAGAACAGTCGGAAGCTCACTCACC
CACAGCCGATGAAATGACGAGCGGTGGGGAATACGGCTTTGGCTATGAGATGGTCAAGTCTCGGCGGCAACGTTGGCGTGGAATGGACGAAGAGTGCATG
TCGGACACGAGCACGGAAGGAGAGTCGATGCGCAAAACATCGTCGCCCCCGCCTTTCGAGCGGGACGGCGACAACAACAACAGATACCCCAGCGACGTGG
AGCTTACAACCGATGACCTTGCCTCGAACAACAACCGTAACAGTTCAACGGCCCTAGAATCGCTTCTAGATGACCAGGTTACCCAGCTCGCCAGTCTCTA
CGTTCAAAGAACAGAACCGATGCTGACGAACATGTTTCGGCGATTGACTCGCTGGACTCGCTAGCCGTGTGCGCATCCGTCACAAATTTTGGCTCTAGTG
TTGACGATGAGTACGACGGTAACAACCAGATTGGACACTCGGTACCGCTGTCACGTGGACTGAAATCTGATCTTCTCAAGCACAGCAACTCGGTGGCGTC
ACTCAACTATTCGACCGTTTCTTCGAATTCGTCTCTGGCGGGCTATGGTCTTCACCTCGCAACCATGGCGCAGTCGAAGTCAGGGTACTACACCAGTGTT
GCCGCACTACTTTGTTTGGCCCGCACCCGGAGCCGTATCCGAATGCGTCCCACCCAGCGAACCTTCCCCAAGACGACTACAATGTGTACAACGTGCTGAG
CCCCGAGAACCTGCGCTTCCACGACTGCCAGTCTCTGCTTCAAGCTGCCGAAGAAAGGAGCGGACAGAAGCCACTACGCGTCGCGGGTTTCCGTTCACGA
CCAGCAAAACTCAGAAGGCGGCTTCTTTGCCGGGGGCGAACGAAGTTCCCGAGCGGACACAATCAACCGGTAGCTTGTTCCAGCGATTCGTTGTGCGGCG
GCGATAGCCTGCCCTGTCATCCCAGTCCATCATCTCAAAGCCCCGCGTTCGACGAAGACGCAGGAGCTCGTTTGTTTTCATAACCCCCAGTACCAGTAGT
GACGTACGTCGTCCCAGCAGAGCGACCCCAAGCAAGCCAAACATCTTCGAAAACACCAGAAACAGCTGCAGAGGGGCAGCTATCAGCCAGGTCGCCCGGT
AGCGAGAGACTTCGCTGGCGAGCGATATTATGAGGAAGGCGAAGCAATAGCTCGGTCGAGTGCTTTTTTTGCTTCCCCAGTGTTTGGTAGCGGTGGCAAG
CAACGCGTCTCCATTCAGCGAGGTCCGCATCAGAGTATCTAACGAATCCCAACTAACTGCTTCCGCCTACTCTCATCACGAAAACATTAGCGTAGCATTT
TGCGAGGATGGAGCCCTGTCCATCAGCGTTTCATAGTGTCCCTCTTGGTATGTGATTGGTTAAAACTAAAGTTGCCTTATCAAATTTAAATTTGGGATTG
ATGGGCCGGTGGCAGCGCGAATACGAGCGGGACTGGCGCGACTACACGCAGCGAGCGATCGCGGACCGGTTTGGCAAGTACGCGGTGCAGTTCTCTCCGT
CGGTGACGTCGGAGGACGAGCAGCTGCTGCGCGAGGTGCTGGCGGATGTGGGTATCGCCCACGTGCCCGAATCACAGTCGATGGCACGCGCCAATCCCCG
CGTCGCAGTCGCTTTCGGCCGCTTCCGGCCGCACGACTCAATTATATCCAATGGGTCATATGTGTACAACACCCCGCCGTCTGCAGACAGCCAGAGCATG
TTCCCGGCCTTCAGTTCGCAGGATTTTGGCTCGCAGACGACGTCTCAACGACGAGTGAGCGCCTCGCAGCGCTTGCAACTGCGAATGGCAAACGTGTCGC
CTATTGCAGACAACAGACGCGCGTCTATTGAAATGGCGGGGACGATTTCGCCGCCTTCGGGTGCTACCAGTCGCCCTGGTCACCGGGAGCGGCTCCGTGG
TCGCCGAAACCGACCGAAAGTCGCGACGGACACCACGTCGATCCCTCGAACCAAGCTTCAGAGCGGATGATTTGGATGTGTCAATGCAAAGTATGCAGCT
TAGTGATGACGAGCGGACGCGCATGGATGAGTAGATGTAGAGGTGGAAGATACGCAGATGCTTGATATGTCTGAAGTACATGAAGGTGGAAATGCTTCAA
AGGGAGAAGAAATTGAGGAACAACATGAACACACGCAGATTGAAGAGAAAGCTGCCGAGGAAGTTGTTGTCGAGACTCAAATGGTGGATCATCACGATGC
TGCTGAAGATATGAATGTGTCCAAGGAGCTAATCTTCAGCAGTGATAGCGAGGAAGAGGACGAGAACGAGCAAAAGGAGACAGCTGAGCCTGAAGCTGAA
ATGGCTGAGGAAGAAAAGCCAATTATCGAGATGAGTGGCACCGGTGAAAAGTCTATTCATTCATCATTACCTTCAGCACAGCCAAAGGACAATACTGAGA
GGCCACCATGGTCTTCGGAGCCTGACTTCGAATTTGGAGACGGAAATGAATACGTTGATGTGGAACAGCAACAAGAAAATGATCACCCGGACACAGAGAT
GCTTGAACCAGAGCAACTCGCCGTGGAAAGTTTGCCTCATACATCCGATGCCTTTCAGGTCGTTAGGGAGCCGACTCCGCAAGGCACTCGAAGGCAGCAA
GAACCCTTTGAAACACCGAGTAGAACGAACACTCCGGCTTGTCCAAACACGAACCTTGCAGGAAACTCGTCAAGACGGTCAACGCATGCATCCCCCACAG
CTTCGTCAACAAAAAGAACGTCGTACCCGACCCCCACTAGCTTCATCCGCGAGAAAACGAACATACGCTTCACCAACGGTTTCCTCAGCAAGACGTACTA
CATTTGCATCTTCTACCGCTTTATCAGCCAGAAAAGCTTCGCATGCTTCACCTCCCGCTTCATCAGCAAGGCGTGCAGCTCAAACGCCTCCCACAGCTTC
GTCCAGGTCAGCATTATCAAGGAAGCGCGCCAACCGAGGCGCATTGTTGCACACAAAACTTCCACTGGAAATGGAATATCGCTTTGCAAGCGATCGACGC
CGTCGCCATAGGCGTCGAAAGTCTCTAGCCGCCAAACCAGGCGTGTTCCCTTTCGTTGTGCCGGAGCTCCTGGTTGAGTTGCAACCATACCAGAAAGAAG
CGTTGCAATGGATGCTGGGACGAGAGGAAGATCCTAGTGATCCTATTACGATCGATCAACAGCGCCGTGGTGAAGCAACAGCAGTTGACGCTCTGGTCGC
GAAGGTGTGTGGTGGAGTCTTGGCAGATGAAATGGGACTTGGCAAAACGGTATGCTGCCTCGCACTTATATGTGAATCTCTTCGTCAAGCTCGCGCTGCC
GATGCCCAAGCAAGAAGTGAAGCAGGCGCGGCGCCTCGGCTTACTCCTCCTACCCTTATTGTGACTCCACTCTCCATCTTGTCGCAGTGGGAACACGAAA
TCCGAGCCAAGACCAACTTGAGTGTGGTGACGTATCAAGGTGCCACGCGCAAAAGCTTCCGCTCTGCAACGCAGTTTATGGGGGCAGATATCGTGCTCTC
GACCTATGATACTCTCCGCCTATTGGAATGCAAAATTCGAGACAAGGACAGTGATGGAGATGGCGAACAAGACAACGGCGATGGTACTGCTTCAGGAGAT
GGATGGCATCAAGCGCCACGTCTTACTCCACAGTCGAAGAGACCGGTGGTAACTTCGAAGCTGCATCAGTTGCAGTGGTTCCGAGTCATCCTTGACGAAA
GCCACCTTATCGCGAATGCTGGATGCGCACGAGCGCGAGCTGCATTCACTCTTAGCAGTAGACGCCGTTGGTGTGTGACTGGCACGCCCATCCAGAACCG
AACGGCAGACCTTGTAGCTCTACTGCAGTTTGCTGGGCTTGGTAACCGTGCGCACGCACTTTCTGAACGTGAGCTTGGAGCATTGGTGCCGCGTGTAGTA
ATGCGCCGACTCAAATCCGCGGTGGATGCACGCTCAAGAGCTCCTATCTTGGACTTACCGGAGAAGACTGAAGAGCTTATCGAGCTTGACTTTGCTTCAG
ATGTGGAGCGCGCTTTGTATATGCTACTGCATCGCTCTACTAAAAGGCAAGTGCTGCGGTATCTGCAATCCAAGGAGTCGAAGCAAGCTCATCGTGTTCC
CGTCACAACTCCAGCCAACGACGGGGACGAGCGCCCGCTATTCATGCACGTCTTTGAGCTCATCCTGCGGCTGCGGCAGGTCTGTGATGCAACTTCACTT
GTAACGAAAGACCCATTGGCTGAAGTGCAGACTCGGGCAGCAAGTGCTGAAGCACTGGTAGGGAACGGATGGGACGGCATTTCTCCGTTCTCCTCTGGAG
AAGCAGCATTGTTGAAGCGGCTTCAAGAACGCCGCGCTGATGGAAATGCTGTGTCTGGGTGCGGTCCATTGGAATCGACGAAGCTAACAGCATTAATGCA
GGAGCTGAAGAAGGTGCGAGCACGTCGTGAGCGTGTACTGGTGATTTCACAGTGGACAAGTTTCTTGGATGTGATAGCGGAGCGCCTTGAGGCTCACAAC
TCTCGGTGCGAGAAGTGCGTTTCATCCTTTGAAGATGCATCGGAGGTGGGCAATGAGGTCATCTCGTTCGCTAAACTGGATGGAAGGATGTCAGTCAAGG
ATCGGGAGCAAGTCGTGCGTAATTTCCAGCAGCACGAAGACAACCTCGGCATTGGACCGGTCGTTGGCCCACCACTGGACGTGTTACTATTGTCCCTGCG
CACGGGTGGTCTCGGATTGAATTTGACTGCTGCGGCGCACGTGTTTATCACGGAGCCTAGCTGGAACCCCAGCCTTGAGCGGCAGGCTGTCGATCGTGCT
CATCGATTTGGCCAAACAAGGAACGTGCGTGTCGTTCGCTTCATCGTGAAAGGCTCCATTGAAGAGCGCGTGGTGGCTTTGCAGAACAAGAAGCGCCAGC
TTACGGCCGCATTCTTGGGCGATGGCGATGACCTCTCCACCGCCAAGAAGAACCGGTTACGTGAGACGCGGCTGTCTACAGGAGACCTCAGGAGGCTGTT
CCTCACGCAGCAAGAAGAGCAGGACGACCAAAATAACGCCAGCAGCGCTCGTCGTGGTGAAAATGCTGAAGACAGCGACGGTAGTGTGACCTGCATCGAG
ATCAGTGACTAG