Transcript Name :
Phyra_g11621
Orientation:
(-)
Number of Exons:
3
Description :
Transposable element Tc3 transposase putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-242
NN-scoreoddsWeighted Score
0.6645.1190.01
*** None ***
TypeScore
cytoplasmic43.5
GO
*** None ***
*** None ***
*** None ***
Sequence
        2461 bases(100 bases per row)
TGATTTGGGCGGGGGTGAGCTGGCATGGCAACACCGAGCTGGTCTTCCTGAAGGGGAAGCAGAACTCTGTCAAGTACACCGAGACGCTGACCTCCAGCAT
GCTTCCTTGCCTTCGAGAACTGGGGTCAAAATTGGGCAATTTGACCCCAATTTTCCAGCAGGATAACGCGTCCATACATGCCTCGAGGCTCACCAAGGGC
TTCCTAGCCACCCATAACATCGAAATGCTGCCGTGGCCTGCCAAGAGCCCCGATCTGAACATCATAGAGAACGTGTGGGGGCTCCTGGCTGGCCGGGTGC
ACGCCAACGGGCGCCAATTTGACAAGCCTGCCGACTTGATCAGACAGATCAAGTTGGAATGGTCTCGCATTGATCCTGCGTATGTTAAGAAGTTAGTGCG
AAGCATCCCGAAGCGTCTGGAAGCGACGCGGCTGTTAAAAGGAGCCAAGACAGGTTACTAGGCCGTAGCATGTAGAGCCTCCAAGTGCGGCTATACTTCT
GACCCGACCTGAAACCAGATTTTGCCTCCTGGCTCCAAGCCATCTTGATCTTTTCAACTTCGCTTGCTGTATAAGTTTTCTATTCCTTTACGACGGCCTC
GGGCCCTCAGTTTGCAGGAAGTTCTCAGTTCCCGGCGCAAGAGCTCCGCTTGTCCGGTGCGGCTATAATTTCGGCGCGTACTGTAGATCTACCTATATAG
ATCTACCTACATATGTAAATGGGAGGGGCCCATTACATGATGAGACACCGCCCACTGTGGGCAATGGACCGCCACAAGCAATAATGGTGAACAGGACGTA
TAGTCCAATGAGGGGAGTTGCAACGCCAGTAGCACCCACCGCTCCTGGTCGTGGCGCCATACAGGCCTCGACTGTATCGGCGCCAGAGGACGTATGTAGC
GGGCCTACACAGTCGGTTCACCTCCTACCTTAGTGCAACATGCACTAAGGCATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGC
ATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATAT
CAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTACACCAAAGCTTCGTTCGGTTCATTTATCTAGGTTTAAGTATACTTGTGGATAC
AAGTATACTGAACTTAAGTAAATTACTCCTACGCTTCCTCCTACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGG
TAGCACTTTGTAGTCCGTCCAACGACCGACTAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTA
GCCCAAACACGTCTGCAACGCATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGA
AGCGGCGGTAGCAACGATGTTGCGAACGCTATCACCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGA
ACTTCGGTGTCGCCATCGGCCACACCGCGCGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGCGAACCTCTCCTCCGTTGGCTTG
TCGAGGTCGACACTGCCATTACGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGC
GTACGGACGCCGACTCACAGATCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAGAACGAGTTCCGA
TCGAGGGCGGAGTTCCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGAGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGA
TTGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGC
AATTGCGCTTGCAATGCAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTGATGCCACGACCGGTGGCAAGGCCGTCGGGA
GGTCCCGAACCAATGGACCTCTCGAGTGCGACCGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTC
ACTATGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAATCAAAAAACTAAAGGGACCAGCA
GGCGCGGGGCGCCCTGCTGGTGATGCGATCGAGCGTGTCGACATCGGACACGCTGCAATGA