Transcript Name :
Phyra_g11486
Orientation:
(+)
Number of Exons:
7
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Reverse transcriptase12.196PS50878
Integrase, catalytic core14.827PS50994
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1457
*** None ***
PositionContextScore
603KNARAAR|YA0.708
1265QTERANR|VV0.511
*** None ***
GO
Biological ProcessGO IDPrediction Method
RNA bindingGO:0003723IEA
RNA-dependent DNA replicationGO:0006278IEA
DNA integrationGO:0015074IEA
*** None ***
*** None ***
Sequence
        6334 bases(100 bases per row)
ATGAACGACATCTCGAGTATGTCGTTGGAGCACGAGAACTTCCCGCACCTGACGCTGATGGAGTGGGAAGCACTCCACCGCCTGGCAGCGGTGTCAGGCG
ACACGGTCGTCAAGACGCTCCTGACGACTGGAACGGAACACGAACAACGCTTGTGTGCTCAAGAGTTCTTAACGCGTGAGCTCGCTGATCTACGTCGGCG
TGCGACGACTCCCACGCCGTCCAAGAACAAGACCGACATCGTCAAGCTCGATGTCTCCACATACAGCGGCGAAGGCAAGACCCGCCTTCACCTGAACCGC
TGGTTCTGCGAGGTGGACATAGCGATCGAAGCTCGGCAATTGTCTACCGAGCTCGCGCGCACGCGCTTCCTGCTTTCCAAGTTGTCCGGGAAGGCGAAGG
AGTGGGCGCTCGGCCGACTCGTGGCCGACGCCTCCTGCTTCCCGACGATGGCAGCTATGCAGGCTGACCTGCGACTCGCGTTCGAGCCGCCCCAAGATGA
AAGCGTTCAACGGTCGGCATTCCTTTCGCTAAAGCAGGGACGTCTGACCATGCTCGAGTACATTCAACGCGCGCGCCATCTCGCCTCGTGTATCACGACG
CAGCCAGTCGACATGGCCACACAAGTCCACGTCTTTGTCTCCGGTATGAATGCTGGCTACCAGCGCTTCTACTTGACCCGCAAGACGCCATCGACGCTGG
AGGAAGCCTTCACTGTCGCTTTGCGTGAAGACTATAGTGTGTCGGCATCGCAAGCTTTCGATGTCTCACGGCCTCTTGTCCCTGACCCAGAGCCCGAACC
CATGGAGGTGGATGCTATCCAGTCCTATCGCGGACGTCGGGAGCCGACGTCGCCTTCACGCCAATCCTCCACTCGGGGTCGCGTCCTATGAAGTGTTTTC
GATGTGGCAAACCTGGCCATCGCGCGGCGGTGTGTCGTGCTCCGTCGCCCATGGCGGCGAACGCTACGACTGCGAACGACGTCGCCGCTCCAAAAAACGG
CGACGACCAGTAGGTGCGGGGCGCCCTACTGGGTGTGTACGGAGCGATGGTTCTCTGGTGGCAGAACCTCCTCCTAGCCCTCCGTGCTTCACGCACGCCT
ATCAGCCACCACATCTGGCAGCGACTCGAGACTGATCGTACTCAGTCTCCACGTTGAAGGTGCACAGCGCCCAATACGCGCCCTGCTGGATTCCGGCGCG
ACGAACAACTTCGTTCGCGCCGCGAGTTTGTCGGCATTGCCGGCGGACATGAGCATCCGCGAGAGCGGCGGTGAGATGATCGTAAAGTATGCTGACGGGA
AGCCGCGGCGTACGCCACGGCGATCTGCCACCTTCGCGTACGAGTTTGACGGGTTCCGCGGCTCGGAGGAGTTCTTGGTGATCGAGCTGAGTGGCTCCTT
CGACTGCGTCTTCGGAATCCCGTGGCTCGCTCGCCACCAGCCTGCCATCGATTGGCTCGCTGGTACAGTCCGCCCCCGCGATATCGACGTGAATGCCGTC
GAAGCGTTCCTGTGCGGAACGCCAAACCAATGGCCGCATGTTACAGTCATGGACCCCGAATCCATGGCCCATGCTGCACCCGAAGCGAGCGATGGCCCTT
CATGTGCAGTATGCGAAAACGCAACCTGCGCCGGTCCTGAGCAGGAGTCTCAGGACGCCGATGTGGTCGAGCATGGGTTCCCACGTCCCGATGAGCAGTG
GTTCTCGGATGAAGACGATGATGACGTGGTCGAGCATGGTTTCCCACGTCCGGATGAGCAGTGGCTCTCCCCGAAGAAGAAGATGACGTGGTCGAGCATG
GGTTCCCACGTCCGAGTGATGATGTGGTTGAGCGTGGCCTCCCACTTGCGGTCGAGCATGGATTCCCGCGGGTGGTCGAGCGAGAGCTCCCCGAAGAAGT
TGACGCGGCCGAACAGCTGGCTCCGCGTCTTGGTGCCGATGTCGAGTTCCGGCACCCCGAGTCTGCTGACGTGATCGAGCATGGGTTCTCACTGTCAGCT
GTGGAAGACTCTCCACGCCCGGTTCGTCGTCGCGGTCGTCGTAAACCGCGACGACCTCGTGCGCCGTCGCGGGATCCAGTCGAAGCTGAGACCGAGATGA
TCTCAGTCCTGGTGGGGAATGACGCGGACGAACCTCCGCGTGCGTGCAACGTCGAGGTCGCACGTCCTCCATGCGACGCTGCCGAGATCACTCGACTGCC
TGGCCTCTCGTGGAAACATTTCCTTCGCGACTTGAAGAAGGGCGAGATCGAACAAGTGTGCATGATCGTCGCCGAAGACGCCGCATCCATCGCAGCCGTC
GAGACCCACGCATCGGACTCAACGTCCGACGCTCGCACACGTCCGAAAGGTGCTGAGCCAAAGAACGCCCGCGCAGCACGATACGCTGCCCAGTCGTTGC
CGGCTCTAGAGGCTGCCGGCAACCCAGTCGCTCCTCTTGTACGCGAGTTCAGCGACATCTTTCCGGACAAGGTTCCAGCCGCCCTTCCACCCGATCGTGG
CGTTCGGCACGAGATCGACCTCGTGCCAGGCGCGAAGTACTGTGTGACGCGGCAGTGGCCGCTTCCCCGAGATCAAGTCGAAGCGATCGACGCTTTCTTC
GAAGGTCGCCGGCAAGCCGGCCACGTCCGCGAGAGTCTGTCCCCGCATTCCAGCCCGACGTTCTGCGTGAAGAAAGCCACCGGCGGATGGCGGATCGTCC
ACGCCTTCAACAAGCTCAACGACGCCACCATCCCGGCGCAGACGCCGATTCCGAGGAAAGACATGGTGCTCGACACCATGTCCGGCAGCACCAAGTTCAG
CGCCATCGACCTGATGGATGGCTTCTACCAGATCTTGATGCGCGAAGCCGACGTGCCGTTGACTGCCGTCAGCACGCCCAGTGGAATGCTCTGGGAATGG
CTCGTGATGCCGCAGGGGCTCAAGAACGCCCCTGCCACCTTCAATCGCATGGTGTCAAATCTGCTCCGGCCGTTCCGCGACTTTGCGCCCAGCTACTTCG
ACGACATCTTCATTCACAGTCGTGCCGCGGGCGGCATGACGGACGTCGAGATGCACCTTCAACACCTGAGGCAGGTGTTCGAAGTGATGAGGGAGAACAA
GCTGTATGCCAACTTGAAGAAGTGCATCTTCTGCGCTCCCGAGATCCCAGTGCTCGGGAGCTACGTCAGCACGGAAGGTGTCCGTGCTGACCCGGAGAAG
ATCGAAGCCATCTGCGCTTGGCCCGCTCCTCAGGATCAGAAGCAGCTCCGGCAGTGGCTTGGTCTCGCGACGTACCTCCACCACTACTCGAAGAACTTCG
CGGCAATGATCCGTCCGTTGTCGCAGCTTCTGAAGGCAGATGCCGCGTGGTCGTGGCGTCCTGAGCACCAGTCGGCTTTTGACGCGGTGAAGACGAGCTT
GTCCACCGCGCCCGTACTCATGCTTCCAGACCACTCGAAGCCCTTCCATGTCGTGTGCGACGCGAGCGACTTCGCGATCGGCTGCGCCTTGATGCAGTTC
GATGACGAAGGGCGCGAGCGGGTCATCAGTTACCAGTCGCGCCAGCTGAAGCCGGCAGAGCGGAATTATCCGGTCCATGATAAGGAGCTGCTGGCCATGC
GGTACGCCCTCATCAAGTTCCGCGTATATCTCCTCGGCGAGCAGACCTTCGCGATCTACACCGACCACGCGTCGTTGAGAACAGCGACGAAGAGCCCTCA
CTTGTCCCAGCGCATGGCGCGCTGGCTCTCGCTATTCTCCGAGTACAACTTCGTCGTCCACTACAAGCCGGGCAAGGCCAACATCCTCGCCGACGCGCTC
TCGCGTCGGCCAGACTACGTGCAGTCGGTCGACACGCAGTTGGCGACGAGGATGACGACGAGTGCGCTGTGTGTGTTGCTGAAGAGGTCGCTGCAGTGGA
AGTCGCAGCGACTACTCCACTCCGAGACCTGATATCGGCCGCGTACGAGGCGGACGCGGCGTGCTCCGAGATGATCAAGTACTTGGGAGACCCGTCCGAC
ACGGCGCGGCGCCGATTGTCCGCACGGAGCCGTGCCCGCATTGATCGATACCAACTGGAAGGAGGCCTGCTGACATACAGCGTCGATCGCGCCGATCCGC
CGCGCATCGTCGTCCCGCTGGACGATGACCTTCGGGCTCGGCTGATTCACGAGTTCCATGACGCTCCCAGCGGCGGCCACCTCGGACGCGAGAAGACTTT
CGCGTCGCTCTCGCGAGACTTCTATTGGCCGCACATGTACAAGTGGGTGCGGAAGTGGGTACGCTCCTGCGAAGCGTGCCAACGAGTCAAGCCGTCGCAG
TCGAAGCAGGCCCCGCTTCGACCCCTCCCAGTTGCGGCGGATCCGTGGTCTTCCGTGAGTATGGACTTTGTCTTCGGGCTGCCTCGAGATGCTCAAGGCC
GCACTGGGATTCTCGTCTTCGTAGATCGTTTCAGCAAGATGCTTCATCTTGCTCCGGTCGCTGTCACCATCACCGCGGCGCAGTCCGCGGCGATCTTTCT
CGACATCGTCTACAGGCACCATGGACTGCCGACCTCGATCATCTCCGATCGCGATCCCCGCTTCACCGCCGCATTCTGGACCGAGCTCTTCAAGCTAGTG
GGGACGCGGTTGAAGATGTCCACCGCGTCACACCCAGAGACGGACGGCCAGACCGAACGCGCAAACAGGGTCGTCGAGGACGTGCTGAGAAGCTTCGCCA
CGTCGTTCGAGTCGTGGAGCTCGTTCCTGCCTATGGTTGAGTTCGCTCTCAACAACGCCGTTCACACGTCGACCGGTCTCACGCCATTTTACGTCAACTA
CGGTCGCCATCCCCGCGTTCCAGCGCTCCTCGGCATGGAGCGCTCGATTCCCCAAGGCGGCGCTGACGACGAGAACGACTCGGCGCACCTTTCCAATGCC
GACCAAGTGCCCAGCGGCACTGAGGCCGCTGACGGCGCTACCTCCGCCTTGATGAACGGTGTCACGACTCGGCACGGTGCCCGAGCCTCAACTCGAGGCA
TGCGTACGCGTGCCGCCACGAGGGCGGCACCATCCGACATCGCATCTTGGACACGTCGGACGCTGATCAACCCACGTCAGCGTCCTCGTGCAATTGCATA
TGAAGACACGTCCGGCGCGGCGACCCCGCCGCGCCGCCTCCAGCAAACTTTGACCCCATTCCGTCCCCACAACCGCGCGACACAGCGGCTGTCAGCAAGT
TCTTGCAGCGACGCCAGAGTGTGGCGCGCTATGTTCGTGACGCGATTGCAGTGGCAGTCGATCGTCAGAAGGAAAACGCTGATCGACGCGGCCGCAAGAA
CATGGAGAAGTTCGCCGTCGGCGACCGCGTCTTGCTATCGACGTCCGGCATTCAACCCATTTTGGTTACCAATTTGGGCGCGAACAAGCTCGCGCCAAGG
TATATTGGACCATTTCAAGTGTTGAAAGTGTTAGGAGATGCCTACACGCTACAGCTACCTACAGCGCTCCGGCTTCATCCTACTTTCTACGTCGGTCGGC
TGCGGCGATACCATCCCGCGCTTATCCCCAGCGACGACGCTGCCACTCCCCAGCGTTCCGGTCTTGGCCCCGCTGCGGCGATTGGCGCCGCGGCACTCGG
CGACGCAGCTCCTGGTTCTCATTCTCCAGCACGTCCAGACGACGCGCCATCCGATCCAGACGCTGCGCGATCGCAGCGTCCTGTCCGCGATTCTCCGTTT
GAGCGGGACGGCCCCGCTCCTCTCGTCGATGGTGCTGGTAATATTCGCCACGTGGTCGAGGCCATTCTCCAGCACGATGATGCCCGTGCTGCCCCTCGTT
CCGGCCGTCGGAGTCGCGGTGGTCGTCACCGCGACGACCCCGTCCCCAGTCACCGCCAGTATCTTGTTCGCTGGCTTGGCCCCATGCCGGATAGCTGGGA
GCCCCGTGCGATCCTTCTTGCCGACATTCCGGACTGCGTGGCGGCGTACGAGGCAAGCCTTGGAGAGGGGGCAAGTCCTCCGGACGGCGCGGCGCCACGC
CGCGCCTAGACGCATGAAGCGAAGCTTCGAATCTTCCTATCAGTCGACGCTCGGACTCGGTGAGCGGATACTCCTCAACCTGGCGCTGCCACTCTTCTGC
ACTCGGTCGCGGGAGATCGAACCCGCGACATCGTGGACATCCTGTCTTGAAGTGCACGAAGCAGGATTTGCGGTCGGCGTCGTACGACGTCTCACAGATT
TCGAGGGCCAGAGCACTGACGGACAAGCGCGAGTGCGTGGCCTCGCGCTGCTCGAGTCTCTGCGTGAAGATCTCCTCACCCTCAATGTTCCAGCGCTCCA
CGAAGGACGTCCACGATCGGTCCATGGACCGATA