Transcript Name :
Phyra_g5695
Orientation:
(-)
Number of Exons:
5
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-490
NN-scoreoddsWeighted Score
0.511.1610.002
*** None ***
TypeScore
cytoplasmic52.2
GO
*** None ***
*** None ***
*** None ***
Sequence
        9529 bases(100 bases per row)
TGAAGATGAAAGCGCCAGAATCGGATGCTGAGGACCAGACGGACAATGACGGCTGGACAGAAGAGCAGTTGGAATCTGTTTTCTATCGGAAAGACCTGTA
CAAGTTCCTGACCGAAGATCGAACGATGAAGATCATGCAGCTGAAGCTGATCGGCGATCTCCAAGGTCCGGTGAAGGCACCCAGAGAAGTGTCGAACAAG
TTGGACGCAGTCAAAGCCCTGATGCGAATGCTCAAGGAGGCTGGAATAGTTCTTGGTGCGTTCGATGCGAACGAACTGTTTGATCTGGAACTGGAAACGA
TCAGAGAGGCAACTCTAACTCTCTTCGCCAAACTGACGCCTATGGTGGGCAGCGTGGTCCCGATCCAGCAAGCAAGATTGCCTACGGTCCGCAGCCAGAC
GGGATCTTCCCAATACGCGTCTGCCACGTCAGAGGCGGGGTCAGACAGCTCGGTTGAACTGCAACGAATGACACTCGGGCCAGTTGGAGTAGCCATGTTA
CGATCACACAAAGATAGATCGGAAGTCAAGACATCAGCTGACCCAAGATCTGGCCAAGCCCAAGCAACACCCGATCGCATGCAAACCTTTTTCAATGCAG
CGATGGAGCGTTTCTGAAGGAGCAACAGACGCCGGCAGTCCCGCAGACGGCCGATCGTCCTGTTATCGATCGGACCAAATCGCCCGGAGCTCAAGACGTC
GAGATGGAATCAGTGGAATCAAACCACGTGGTCCACTCTCATCCAAGCGAATACGATCCGGATGATCTGAGCGTAGGAACTCCTACTCGCGCAGCGGTCG
CGTCCGCCGAAAATTCTGGTGGCGGATCGCTCTCTGCTACTCGAATCAAAGTGTCGGCGATCTCTGAACTAAAGGAGTTTTCCGGAAAGGACAATGACGA
GGACCGCGCCAGGGGTTGGCTTAGCAAGATGAAGTCTGCTTTCATCCGCGACCAAGCACCCGATAGCGAAAAGTGTTTGGTGTTCGGCGATCTGCTCAAG
GGACCAGCGCGTAACTGGTACCGACAGCTAAGCAGGACTACACGGAGTGACTGGAAGAGTTTATCTCAAACGTTCCAGACGCAATACTGTGGCAGGGGAG
TATCTGTCGCGAGACAATACTACCATGCACGGAAGCGATCGGAAGAATCGCCGCTGGAATATCTGCACCGTCTCAACGTCGCCGGTCTAAGAGCGCATCT
TCCGATCAAGGATGGGTCGATCGAAGTTCGACGTGAACACGTTGATCACTTCATCGAGACTCTCGACGATCGCGACTTGGCTAACCAACTAGCCTGCTGA
GGGTTCCCGACGCAGACACCTTGGAGGAGACGCTACGGGCGCGACAGAGAGCCAAAGCCCGACAAGGAAAAGCGGTATATGGATCAATCAAGCCGAAAAC
GAAGGCGCCAACTGGTGTCGCTCCATCTGCAAATGCTCGTGCAGTTCGCGCGATCAGAAAAGCAGCGAGTTCGAGTGATTCCGAGCCAGAAGTCAGCGGA
TCAGATGGAGAAAGCGATCTGTGCAAGATCCACCTGGCCGCTACGGCTGATCAAGGGGTGCGATCGACGCAGGAGCAAGATCAGCGACGCCCAAACCGAG
ATGCGAACAGCCGCAGACACGACAAGCCGACTGGGGTACCGGAAGGAGAGTTGCCGAGGAAGCCGTGTTCCCACTGCGGATCGACCAAGCATACGGACTT
GGGTTGTTGGCAACGATTGACGTGCGAGAAGTGTGGCAAGAAGGGTCATCCGACCGATCGCTGTCTTTTCACCTGCAAAGCCTGCGGCGAGATCCACGGA
GCCGGAGAGTGCCCGATGGAAGAGTTTTACAACTTGATCCGTCAGTGGTATAACCCGAACAAGCACGGCGGGATGCTCCCTCAAGCAGCCGAGAAGATGT
TAAACTAGATCGCTCGCCGGGTTTGAATCCGGTACGAGACGAGCGTTCTCAGTTCTGCATCTATGCATATGTCGAGAAACAGTCGAAGTCAGAGGTGAGT
AAGCTGATTCGGCCGACTGACAATACATGTGATCTTCATGACAAGCGTACCGTGGCGATCTCCAGCATCCACCAAGTCGACGAATATTCGCGATCGGAAG
TGACGATGGCCTTGGATCTCTTGCATGGAGAATCCGAGGATATTGGAAGTATCACGTGCCAGACAAGAAGTTTCGCCAGGCGAAAGCCGTGGGGAAGATC
AACAACGAAAAAGCCACTCTGCTGTTTGACAGTGGCGCCGAGGTGTCCATTTTGGATGCCGCCTTTGCTCGTAAGGTTGGGTGCTACATAGATAACAATC
AGGAGTTGGAGTGTGAGGGTGTTGGCAAGAATCCCTATATGGCGGAAGGACGTACCAGAATCAAGATCACGCTCGCGGGATCGCTGGTGTATTACTTCGA
TGTTTGGGTTGGACCACCCACTGGTGGTCAGGATTTGATACTTGGTATGGACTTCATGGTGCCAGCAGGCATTCGTCTTGACCTAGCTGACGGATCGATC
AATCTCCGGATGAGGTGCGAATCCAGTTAGCTGGACGGCGGCAACTCTTCGGAGAGAAGGTGCAACCGATCGATCTGGGCGAACACAGTGTGATCGAAGT
TGGACGGTCGGTCGAGCTCCGGAAGGGACTCATTCTCTCGGACCATCGGAAACTCTGGGTCACCCGTGGTGATCGTTGGGTGCCGAGCCTGGTGGCTGGA
CTAGGGAAGACGCGTTATTTGAAGGTCACGAACGTCAGCGATCAGAAGCTGATACTCCAAGACGATACGCGTATTGGCATGTGGCTCTCTGGTGGTCAAG
TACCTCGCATTCCAGGATTTGTCCTGATCGGCTCACGTCGATACAATGAATGGCAGAATTTAGCGTTCCAAGCGACAACCGATCAGGTCAGCGACGAGGA
ACCTGAACCTTTGCCAGAAGGACCAATGGTGGATCGACCTCGGTATGACCTGCCGACCAAAATCCTGCGACGTGATCATGAAGGATCAAGACCCGTGGTG
GCTTCAGTGATCCCGTCCTCCTCAACGGGGGCGATCACTGGTACGGACTCAGCTGGGAAGTGCAGATTGGTGAGCCTAGGACTCCAGAAGACGAAGAGGT
GTGTTTCCATGAAGGTGGTGCCTTGTTTGCGGAAGACGTGGAAAGCCAGATGGCTATCCTACCCGAAGTGCCGATCACTACCGACGAAGTCACGATCGAA
GACATTCAAGTAGGTGATCCGGAAACGAATACACCTGAGGAGATCGATCGACTTCGCCAGATCATCTGGCGGCGACGACACTTGCTGATCGGTAAAGGGA
ACGCCCTTCCACCCGCTGCGATTGGTGCGGTGTGCGACATCGACGTTGGAGGAGCCGCTCCCATCGCCCAACGCGTGCGGAGGGTGGCCCCTCAATTCCG
AGAGAAACTGTCTGATCTGATCAAGAGTTTGTTGTCCGCGAAAATGATTGAGCCATCAACCTCACCATGGGCATCCCCAATCGTGATCATCATCAAGAAG
AATGGAGTCGACATCCGGCTGTGCATCGACTACCGTTTGGTGAATAGCCTGACCAGGTTGATGGTATATCCCATGCCGCTGATCAACGATCTCTTGGAGG
ACTTGGACAAAGTACTCTGGTACTGCTCTTTGGATATGGCTAGTGGTTTTGGGTGGTCTCCATGACGGAACGTGCACGGAAGATCTCCGCGTTCGTTACG
CCTTTCGGACTCTTCGAGTGGACGCGTATGCCCTTCGGGCTGAAGAACGCCCCACAAATCTACCAGAGGCTGATCGATAATGCTCTGTACGGATACCTCC
GGATAAGCCCTGATCGAGACCACACGGAACCAACCGACGTGTTCGAGAAAGGGGAACCCGAGGCAAACCCGGGACCTTCGGTGCTGGGCAGGCGATCGTA
CATCGACGATATCCTGATCACCGCTGACACCTGGGACTCGATCTGCGAGAAGGTCGAGGCACTGCTTGACGCTTGCGAGCGATGGAACCTGTCGATCAGC
GTGGTCAAGAGTTTCTGGGGACATCGGAAGGTAGAGTACTTGGGTCATCGGGTATCGGCCGATGGTTTGGAAGCCAATCCGAAAGATCTGGAATCGCTGG
AGAAGCTGCCGTTTCCGAAGACGTTGCGATCGATGCAGTCCTTCTTAGGAAGCCTGAATTATTACAGTCGCTTCATTGAAGACTTCGCCGTTTACGCCGC
GATCTTATACGAACTGCGAGAAGTGGACTTTACGAGATGCACCACGGGAAGCATGAGGACCGAGCACGGAGTCCGACGATCGGTGGACTAGAGCGAGGAC
GGCGTTCGACCTACTGAAGGCCAAGCTTGCGACCACCCCGATTTTGCGACACTTCGATTCCGATCGCCAGCCTGTGATCGTGGTCTACGCCAACAAGTGG
GCTATTTCAGCTGCGTTGGTTCAGGAACATGATGGCATGTATTGGCCTGTGATCTTCACCAGTCGTACGCTGAAGTCGAACGAATTGAATTACGGCATAG
TGGACAAGGAAGTTTTGGCGCTCCTCCGGATCTTGGACGTGTGTTACACACTCCTGACCAACCGATCGATCAAGGTGCTGTCGAGGTATTCGACGCTCGC
CTGGTTGCTGAATGCGTCGGGCTTCCAGGGACGATTGGGACGATGGGCAGCTCTGCTGTCCGAGTGGACCTTGGAAATCCGGAAGTGCTTGAAAGGAGAG
GACGAAATCCTGGGCGCGATCGCCGCCAGCATTACACCCCGAGCGGAAGTGGACGAGGCCTTGATCGCGATTGCACCGGTGAAAGAGCCCAAACGAACGA
TCGTGATGGCCCCGCCGACGGTAGAGCTGGATGAAGAGTTGCTCGTCGTCAGTTTTGATGGGTCAGCACGCGTCAAGCGGAGCGCCGGAGCGTATAGTGC
AATTGTTTGGAAGCTCCCGGAGTGGTCGATCATATCTGCCGCGTCCGAATTCGCCGACGATCTGACTGTCAACGAAGCCGAATATCGCGGACTTCTGCTA
GGCTTCAAGCTACTGTCCGATCAGAACAGGGGCGAGTTGTGATCTGTGGAGATTCCAATCTGATCATCCGACAGATGCGTGGTGAAATCGATTGCAAGGC
ACCGGGTCTCCAGATACTACGTCAGAAAGCGATGGATCAAGTGAAAGCCTGGCCGAAGCACGAATTCCTCCATGTGAAGCGCGATTGGAATCAGAGCGCC
GATCGGTTGGCAAGTGCGGCACTGCAACGAGAAGCAGGCGTGATCGTAACTGATGAGGGCGAAATTGGCGATCTCGTCACGATCAACCGCCTGGGCGAGT
TGCTCCACCCGAGTAATGACGACCCCGTCGTTCAATATCAGCAGTGACCCGATCAGCCCGACGGCACCGTCAAGTGCCGGCAGCTATGCAAGAAGAGATC
GTCCAACGCATGAGGAGTGAGAGGTTAGTACAAGCTCAGGATGAAGAGAAGTGGATCGTGGACCTGAAGTCGTACCTACGGGGCGACGTAGCAGCCTTGA
CTACCAGAGATGCAAAAGCGTGCGCCAAGATCGCTGGAGATTACGAAGTGGGGGAAGACGGCCTGCTGTTCTACTGTGTGAACACCACCCGTTAGACGAG
GACCGAGATTCGATCGCGCGTCTGGTGGTACCTGCAACGTTACACCAAGATTTCCTTCACCATTATCACGCCAGCCTTGAAGGAGGGCACCAGGGAATCG
GGAGGACGTACCAACGGATCAAAGCGCACTTCCACTGGCGGGGCTGTTCAAGAGTGTCCAGCAGTTTGTGGGTGAATGCGTGGATTGCGAGACAGGGAAG
GGGCGCCCCGTGGTTCAAGGAGAATCACCTGGGAATGTACGGGCCACCTACCCCTTCCAAATCATCGCGATGGACCACATCCCATCTCTGCCAAATCGTT
CAAGGGCAACACGGAGCTTCTGTGTGGGTCGATCTGTTCTCAGGGTACGTGATCGCTAAGGCCGGCGCGTCTCGGACAGCGCAGACCATCGCGGAGAACT
ACGAGGAATGCGTTTTCCGCCGCTTCGGAGCCAGTGAAGCGATCCGACATGATCGGGAGCCCGGTTTTATGTCTGATTTCTTCCGCGCATTCAGCCGTAT
AGTGGGACAACGACAACGAGCCACCATGGCCTATCGACCACAGGCAAACGGTACCGCTGAGCGGATGGTGCAAACGCTTACTCGCGCTTTGAAGATGTAT
GTCGCCGATGTGAATCAACAAGACTGGGACGAATACGCGGAACGCCTGACTTTCGCGATCAACACTGCTCACGATCGAGTACGAGGAGAGACGCCGTTTT
ACCTTGTCCATGGCTGGGACCCACGATCGACCTTGGAAGCGTCGCTACCGTTAGGCAGCACGCGACGTCGCGATCGCGAGCCGCGCAGATGGAGATATCG
TATCCAGCAACAGTACCAGCGAGCTCGCGAGGAGGTCAACGCGCGCCTGAAGGAGGCGATCCAAACGAGAGCCGATCGCCACAACGACGGGATAAGGCCG
CACCAGATTGAGGCCGGGTCACAAGTGTGGCTATATTTGGATCGAGTTAAGGAGGGCTATGCCCGAAAGCTGGCACACATGTGGCACGGACCGTTCCGGG
TGCGCGAGATGATTGGCCCCTACGCGGCCCGGCTAGAGGTGGCCGGCACCGAGTATCGTCTTTTTCCAATTGTACACGTTCGAAGCTCAAGGCCGTGAAG
GTTTTCTCTGATCGCCCTGACGTGACGCTAGCAACGGACGAGATGGTCGATTTGATTTTGATGAGGCGTTGTTGCCGGAGGACAGCTGGGAAGGTGATCG
GAGTGATGACGAGTTTGAAGTGGAGCGGATCACAGATGTCCGATCGGGCCGTAAGACCAGATATGGACGCGTCCATCGGGAATTCCAGGTCTTCTGGAAG
GGTACACCGAACCGTCTTGGGTCGACGAGGCTGACCTCAACTGCGGGGCTTTGATGCACGAGTTTGAGCGCGAGCGCACTAGACGGAATCGCTTCGGAGT
GATGCAATCGCACGAGGCGGAGGAGGACAACTCGTAGTGATCGCTGCGAGTTGGGAGTGAAATGGGTGCAGGGTGGCTGCACTTAGGAAGAAGGAGGGCA
ACTCGTGGCGATCGCTGCGAGTTGAGAGTGAATTGGGTGCAGGGCGGCTGCACTCAGAAAGAAGGAGGAGGTATATGTACAAAAACAAGTGGCGTGAAGG
GGAGAGAACCGATTACGAGGTTCGATCGACCCGATCAAGGAAGACAACTGGAGAAAAAGAGGTGAAAATGGAATTACATGCAGACTAACACTCAAGTGTA
CGCTTAAGGGGAAGCTGGGATGACGAATTTGCTACGAAGACGCGCAATGCGTTGCGCGGGATGCGATCGGATGTCGTGGCGGTATTGGACTCGCCAGGGC
TCAGCCAAGTCCGCCTCTTGGACTGCGGTGATCAGATTCGTCGCCTGCGAGTTGCCATGCTGCCCTGGATACCACATCTTCTCCTCACCCGGCCGAGGTC
GGTGCATGAAGAAAGGATCGAGCAGAATGTCCAAATCACACCGACCCTCGACCAGTCCACGCAAGATCGTCCGAAGAAAGAACTTCCAGCGAGCACCGAA
TCGTGATTGCCGCTGTTTTCGGGTAGCGGCGAGAGTATCCAGGTAAACGTCCCCGCGACGACTGCTGGTGCTGATGGAGAAGTAGTGCAACGACTCCCAC
ACGGCCTGTGCATGCTCGTGTATCAGGTCCGCATATTGACGAGCCATGGTTGCAAACCAACCCACGAGCACGAACGAAATCGGGGTGACGGCAGTGTGGA
GAGTCTCCCAGGGGCGCGTCGCGTACAACGCCCGGACGTGAGCCGCGGTGATCAGATCTGACCGCCAAGCATGATCACGTGGAGCACGAGCTGCACGCTC
AGGAATCAACCAATTACGTGGCCGACAGAAGTGATGGAACAGCAAGTCCAAATCCAACTCGAGGACACTGATACGACGCATGTATCGAGCGTCCCACGGG
GCGACATCCGCAGCGGGGCGTCGCACGCGCTCGCGATATCCAGGAATCCATTGATCACGAGGCACAGCTGTGCCTTCCAAGCGATCATACTCCTGACGCC
CCAGTATAGCATTCCGATGCGTACGATCGCGACGGGGTACGCTGCCGTCACTGCCTGAAGAGCCAGGTGAGCCACCACCAGGTGGAGAATCGGCAGGGCT
ACCGGAGAGTCAGGTGAACCACCAGGAGGTCCACCAGCGTCGTCTGCCGCCCCGGTGTCGGAACCAGAAGACCAACGTTGATCGGTCGATGGGGCGACCC
TCGGGGCGAAGAGTCGGGATTGTCGACGTCGACGATCAGACGCGCGAGAGCGAGAAAGCGCAGCCAAGTGTCTTCTTCGTTATCACTCAGATCAGAAGTG
ACCTGTGGGGAAGTGGCTCTGCTACGCTGCCTCCCCGAAGTCGCGTCCAGAATGATGCGAGAAGTGTGATGGAGATGTGATGACGACCAGAAGACGCGGC
GAGAACGTCGCGTAACGGCGGAGGCGATTGTGAAAACGATCGTGTACGCCGCCGACGAGAAGGTTGCAGATTCAAACGCCGCGAACCGTTTCCATCCTCG
ACGCTGGCTTCGTCGTCGTCGGCATCTCCGTCATAATCGCCGTCTTCATCGACTGCACCATCCCCGTCGTCGGCCTCGCGTCTGTCTGCACTCATCTTGG
GGATTGCCACTGGGTTGGACAAAGGAGATCAGCCCTGCCACGCGTTGGCGGATGGCATCACACTCACGGACAGCTCGATCACGCGAATCAATCAGTGCCG
CGCGATCAGCACGGGAAGCGGTCAAGTCTCCAGCCAGGGTGGCATTCTCCCGCTGTAAAACTTGCACGCGATTGCGATCGCCCTGGAGGCGAGTAACTTC
GCCTTCCAAGCGAGCGATGGCAGCCCTCAGAGAAGCCACAGTGGAACCTGGAAGACAACAAAACGACATACAGTTAGCACAGAATTGACATGGGCAGATG
ACGCATACGTACGGGAGGACAACAGCAAAGTCGCGGCCTGATCGCGTTCGGTGATCGTCCGTTGGAGTTGATCTCTGACCGCTTGGAGCTGAGTGGAGGC
GTCGGAGGCCTGACGGCGAAACTGGTCGCGTTCAGTGTTACTACGCGCCACATGGCGATGCGTGGCCGAAAGTTGGCGGTCCATGTCGCGTTGAAGGTCA
CCAAGGCGGTCTTCGAGGCTCTTGACTTGGGTCTCATAGTCTCGCACGCTGGTCTCCAGTTGGCGGCGAGTCGACTCGGACGTTTGCAGATCGCCACGGG
AACGCTGTAGGTCAGCAAGCACCCGATCGCGACACGCACCCAACTCCACCAAGTTTCGCTGCTGGACCACTATGTGACGGCTGAGACGAGAAGATCGATT
TGATCGCGCTCGGGGCGATGGAGCGTTGACCCGCGCCTGCAGATCGGAGACCTGTCGCTCGAGAGCACCGATCCGGTCGTGGAGGAATACCACATCCTCG
TCGTGCGATCGACGTTCTGCGGCGAGTAA