Transcript Name :
Phyli_Pl_103956
Orientation:
(+)
Number of Exons:
2
Description :
hypothetical protein PHYSODRAFT_354317
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-188
NN-scoreoddsWeighted Score
0.8992.5580.005
*** None ***
TypeScore
mitochondrial91.3
GO
*** None ***
*** None ***
*** None ***
Sequence
        625 bases(100 bases per row)
ATGCTGGCCCGTGCTCTCCGATCGTCTGCGCTGTCGCGCGCCGCGAGCCGTCGCTTCATCGGCGGGTTTGCTGCCGATGCATCTGCTCCTACCGTGGCGG
AGAAAGTGTATGTGAACTCCGTATTAACCTCTTACGACGTCATCTCATGGTATTCTGGTGGTCTAGGGTCAACGTCGTGCTTGTGGACTACGAAGGCAAT
CGCCACGTGGTTAAAGGCCGCGCTGGTCAGACGCTGCGTCAGGCCTGCGAGATGAATAATGTGGGCTACGTCAAGGACGACTCCATGGGCGGTGGCGGCG
TGTACAACGCCAAGCGCGCCGACTTTTACACGGAGTCGCTCTTCGGCGAAGGCTCCACGTCTCCGCAGTCGCACGTCGTGGTTTCCAACGAGTGGATCTC
CAAGCTAACGCCTCCTAACAATCAGGAACGCCACATCATCGACACGTACGTCCCGGCGGAGGACCGCTCCGTTAACTCGCGTCTGGGTACGGAGATTGTG
CTGCAGAAGGAGCTGGATGGCCTGGTCGTGGCTGTGCCCGAGGCGCCACCCGTGGAGGAATACAAGTACGAGCACGAGTACGACGAGGACGATTACGAGT
CGTATGACGACGAGCACCACGCCTA