Transcript Name :
Phyli_Pl_110624
Orientation:
(+)
Number of Exons:
5
Description :
hypothetical protein PHYSODRAFT_474645
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Aspartic peptidase0.00000074PR00792
Aspartic peptidase0.00000074PR00792
Aspartic peptidase0.00000074PR00792
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-521
522-544
545-632
*** None ***
PositionContextScore
67QQARTRR|RA0.556
*** None ***
GO
Biological ProcessGO IDPrediction Method
aspartic-type endopeptidase activityGO:0004190IEA
proteolysisGO:0006508IEA
*** None ***
*** None ***
Sequence
        2253 bases(100 bases per row)
ATGACGCTGGCACTGCCTCGATGCACGGAGCTCAGAGCTCGCTGGCGAGCATCTCTCGCTGTTCTGGCGGTTGTAATATGTTGCCAAACGTCCGCTGTAG
TATCCGAAAAGCAGAGTCTCCTGAAAATCCAGCTCCACAAGCAGCAGTCGGTCTCCGATCTATCCTATCGACTGGCACACCAACAAGCTCGAACTCGCAG
ACGAGCGCAGGAGGAGGCAAGTACCGTGGATGGAGATTTTAAATTAGGGGCAGTAGCTCTAAGTGAATCTCCATTGGGCGTAGGTTACGGGTGCGTATGT
GCTGTAATGTTTAGATTGTGGTGAATGGAGCTGATAGCGTACGTTTTGCAGCACACACTATGCTGAAATTTACTTGGGAATTCCTGCACAACGCGCCTCA
GTGATCGTGGATACGGGAAGCCACTTAACGGCGCTGCCATGCAGCTCGTGCAATGGCTGCGGACAACACACAGATCCACTATTTGAAGTGTCCAAGTCCA
CAACAGCAAAATATCTAGCCTGTCATGACTTTGACTCATGCCGTTCGTGCGAACAAGATCGTTGCTATATTTCTCAGGTGTGAATTTCCTACATGTACTG
TATGAAGTGAACTATGTACTAATGTTGTCACTGTGTTATTGCGATCGAGCAGAGTTACATGGAAGGTAGTATGTGGGAGGCTGTCATGGTTGACGAATTG
GTGTGGGTAGGAGGATTTTCCACACCAAGCGATGAAATGGATGGAATTCTGAAGACTTTTGGATTTCGATTTCCTGTGGGTTGTCAGACCAAAGAGACTG
GTCTCTTTATTACTCAAAAGGAGAATGGTATTATGGGTCTCGGACGTCACCGCTCAACGGTCATGGCGTATATGCTGAATGCGGGTCGCGTGACGCAGAA
TCTATTTACTCTGTGTTTCGCAGGTGATGGTGGTGAGCTTGTGTTTGGAGGTGTGGACTATAGCCACCATACGAGCAACGTGGGCTATACTCCTTTGCTC
AACGACAACTCGGCTTATTATCCAGTCCACGTGAAGGACATTAGGATGAATGGTGTATCACTAGGTATTGACGCTAGCACGATCAATTCAGGTAGAGGTG
TGATTGTTGATAGCGGTACGACTGACACATTTTTCGACGCCAAAGGAAGTCGGAACTTTATGAAAGCGTTCCGGGATGCAGCTGGGGGACGGGAGTATAA
CGAGAAGCGCATGAAACTTACTGGCGATGAGCTCGCAAGTCTTCCGATAATTTCTATTATTCTGTCTGGAATGAAAGGAGATGGCACTGATGATGTTCAA
TTGGATATACCTGCGTCAAAATACCTTACGCTTTCCGATGACGGTAACTCGTACTATGGCAACTTTCATTTCTCGGAACGCAGTGGCGGAGGTAAGTTTC
ATGACTGCTTTTTGTGTTTCCGTCAGCCCCTAATTTTCTTGGTTGTATCAGTCCTCGGCGCAAGTACTATGGTTGGTTTGGATGTCATCTTTGATACTGA
GAACAAACGTGTGGGCTTCGCCGAGTCGGATTGCGGTGCGTTACGATTGCTTATTACTCGATGACAGCAATACAAAACAAGGCTGACATCTTATGACACA
GGAAAAAGTTATACCAAAACTAATGTGACAGAACCAATCGCTTCAAATACCTCCACCCAGCCACCGTCTCAAACTGTGGTACCGGTTGCGTCAGAACCAC
CATCGGAAACGACGGTGCCGGTTGCTTCAGATATCAATCAGTCAACATCTGTACCAACGACATCGAGTGCTTCGGATACTACTGAACAACCTGTGTCCAC
AAACACTTCCACTGCGAGCTCAAGCAGCAACTCGTCTATGGGGTCAAATACAACAGTAACCGGGTTGGCGGATGCAGCAGGCAGTGCTGATGCGATATCG
CATCGATCAAGTCCCAAGTTTGGCGCCTTTATTGCCGAAGTTATCCTCATCTCGCTGGTGGGTGTGGCACTTGCCGTCATGGTGTGGACAAAGTGGCGCA
CACGCTCATGGTCCCGCATTCCAGACTCAACGGAGACATCACGTGCACAAATGCAGATAATAGTGGACGATGACACACCACCGACGTCTCCCACGAGAAG
TACACTGTCACCTCGCTCACGAGCAGCTAGAAAGGGTCCATCCCCGAAGTTCACAATCGGCTCCAGTGGAGAAGAAGACGAGCTTCGTGAAGAAGAGGAA
GGCGTGAGTAGTCCCACCTTAGGTCGTGCACAGGGACCGCGTACGAACTTCTA