Transcript Name :
Phyli_Pl_111953
Orientation:
(+)
Number of Exons:
10
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
EF-hand domain9.018PS50222
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-2082
*** None ***
PositionContextScore
1587KVKRSKR|SS0.853
2007ELKRRVR|SV0.512
2077IPKRPRR|VF0.523
2080RPRRVFR|CV0.706
*** None ***
GO
Biological ProcessGO IDPrediction Method
calcium ion bindingGO:0005509IEA
*** None ***
*** None ***
Sequence
        11454 bases(100 bases per row)
ATGGGAACCAGCAAGAGCAAACTCAGTGCACAGATCCAAGCACAGCAGGAACAGCAGTATGCTTCTCAAATGAAGAACCCAGCAGTAGTCGCAGCCATAG
AAACTCTTGAAAGTAAGTGACAAAGTGTAAAGGTCTCGAATGTCTTTTTGACTGCAACTCCCTGTAGTCGACAAACCCACAACCGGATTGAAGTACTATC
GGCTGTTTGCTACGATGGACAAGGAGTAAGTAATTTATCTTAGACTATGTCAATATTTTACAGAACTAACTCCCTGCGCAAGTGAAAGTAAATCTATCGA
TCTAGAGGAATTTCATCAGTTTTTTGAGCTACCGCACACGCCGTTTTCCGACCTAGTTTTCAGCAACTTAGGGAAACAAACTCCGGTTCGAGGCGTGCCA
TTTGATGGTACGAAACTTGTGTGTATTATCTCGGTAATGCTGCTTATATCTCACATCTATGCTGCAGATTTCATGTTAAACCTGTGGAATTTTTGCACCA
TGACTCCACAAGATATTTACACGCACATTTTTCGTCTTTATGGTACGAATATTCCAGTATGAGTGACCTCAGTTGAATATCTTTTATATGGTGGCAGATG
ATGATCATAACGGCACCCTGGATGCTGCCGAATGCGATAGTCTGTTTCGCCTTCTTTATCACACTGAAAGCCTTCCTAGCATTGTAAAGAATCAATTAAA
AGCGATGACTTCGAACGCAGCCGAAGTAATAACCCTTGGTTCGTGCTCTTGAGTATTCAGAGGTTTTAAACTCCCACTAACACGTTTCCCTAATGTTGTA
GATACTTTTTTGACGATGTGCAGTAGCAAAAAAAGCTTGTTCAAACCGATTTTCGAACTACAAACTAGAGCACGCTCAAAGGCAAGTTTCATCCAGCATC
TCTAAAACCCGCTTATCCTTGTATTTTTGTGTGATGTAGAGTCTCGGGGAGTCCTTCTGGGCAAGTGTCAGTAAGAAGCGAAGAAGGATACTTAGCGGCC
ACAAGGATGTATTTGATGCAGCAAACAGCCGGCTTCAGGTCATTCAGCGGCAGCTAGGGGGATCGAGTCCGAAAGCCAACATCTCACTCGATAGCTCTTC
TCGGTCGACGCTCAACTCGTCAACATTAGTGAAGAATACTACTACAGGTAGTGAAGCAGTTGAATCAAAGATCCCCACCTTGGGTGCTGCCAAGCTACAG
GGTCAAGATACGGCATCATTGGGTGCGTGGGCCCAGGGCGAGGCCCAAAAAGAGTTGCAAGCTTATATTACAGCTTTTAGTCAAGCGTACGTCGCTGAGT
GCCACTTGAAAGAACAGTCAAAGAAATCGTCAACTCAAGACCAGCTTTTGCTAGATTTGCGCTATAACGTAGCCGTCACAACAAAAAGTAAGAGTCTCGA
TTTCTTCATATTTTACAGCAGACTAATAAATGCTTTATCACAGGGCGAGATGAAGCTAGAAATGCTCTAGAGGAATTGTGGGAGCAAGAGCAATCATCGC
TTATTGCTGAGCGCCAAAAAGTCGTCACTACTCTGGCGAGGAGTATCTCTACGAAGACACTTCACAAGGAGACAGGGAAAAAGGTTGGTATCACACATTT
TCTGCACCGAATTTCTCAGCTAAACAGTACCTTGTAGTCATCGGCTAAGGTGGTAAAGAGCTACACACAGAAGAAACTTGCGATCGAAGAAAACGCCATC
CGCGGTCGCTTTAGTGAGCGGTGGCAAGCGCTAGAACGCACCGCTGAACTTCGAGCTCAGCGAGACCTTGAAGCATCCAGAATGACAACATCAGCCAAAC
CGATGCTCCTCCAAAAATCAATGAACACTGTCTATGAGCCAAGTAAAAATCGAGTTGTGCCTACCTCTAGAAAATAACATCAGCATTGTTCATAATATAA
AATGTTTGTAGTGCAATGGATAGAGACTGCAATGGATTAACTGACTTGACAGAATCTACCGATGTTGCTGTTGCTGTTGCTGGGCGGCCGCCGCAATTGC
AGCGTCACAATGAGATTGCACACGACTCTCGTATCCTTTCCACACTTGGCACGTAAATGCCAATTCTTCTCGAAACGAGTCGCTTTTCTGTATCAAATTC
AAGCATTAGTACGTAAAATAGGAAGGTACATTGTCTTAAAAAGGTGACACACCTCAATTTGGGTGTTAATTTCCTTGACAACCTCGTGTAGGCGAGCTAC
AGAGCCAGTAATGCGCTGGAGCAACGCCTTCTGCTTCTCTTCATGGGGATCTACATGGTTGGAGCACGCAAATACAGTGATTAGAGGTGCTGAAGGGATG
TATAGCGAGGATGGAGGAGACGTACTCTGCATGTTGGCGGGCAGTTGAAAAATGACTTGGAAATTGAAATGGAGAGTGTTAATTGGCTAAAAACATTATT
TTTAATCAAATGGCTACATAGTGTAGCCATGCGAGTGTTTACTGAGGTGGAATGATGGCACTGAAAGGCGGCGTGGCATCTTCTTTTGGCCGTGACGAAG
CTAGAGATTGCTCCAGTAATGCCATGATTGTTTGCAATTGGATTTCTTGTTGGCTTAATTGCGCTTGAAGCTGAAGCTGCAATAAATTCAATAGGACGTG
TTAGTGCTACTACACATGTCAAAGTGAGGTTGCAATTGACGTGAACGAACCTGCGTCGTGTTTAGCCTGTCGACCTGCTCTTGAAGGCGCACAAGTGGAG
GTGTTGGAGCTGCGAAGGACGAGTAGTTGTGCGGAGTGGAAAACGAGGATGTCGGAACTGAAAATGATTTTGTCCCTACTGGTGAATCTGGTTTCGGTGA
GTCGAGATTGCCTGTTACAATACACTGTCATTAGTAAGAGCACAACGATGCTGCTATCTCAGCAAAAATTACACACCCGAAAAGGCAATGTTGCTGGAGC
TGAGTGCCCGGGTCAGTGAAATGCGAATTGACTCCTCCATAGCTTGCTCACTCTTTTGTTCCTGCTTTTTGAGCATCACCTCAACAAAACCAGAACCCAG
AACAGCACCTGAAGTCGTGAATAGAAGCCCAAGCGAGAATTAGTGCTGGAGCTAAGACACTGTCAGCGTTAGTATTACCTGGAATTGTGAACAGAATGAT
TCCCCATAGTGCCAGTAACGATGAGAAAGCTCGACCCGCAGCTGTGATCGGTACAATATCACCGTAACCGAGAGATGTGATGGTTTCGATGGCCCACCAT
GAGCATGTACCGATGCTTGAAAATACTTCAGGCTGTGCTGGGTTCTCCAGGAAGAATCTTGACACAAGAACAAAAGTAAGCAGCACATTCTAACCTCTGA
AAGCACCGTCGTCACTTACATGGTGGTAGAGGAAGTGAGCACAATGACAATCGTCAAGTAGCTCACGACTCCGAGTTCCTCCTTCTTGAGCGCGAAAATT
TCTCGTAGATTTTTCATCGCTTGATAAGAGCGCTCCAAGTGCAGGAACGACATGATTCGAAGTAGTCGAAATCCCCTCAGTGTCAATACGCCACGCGATG
ACACTGCCACTCTACAAATTATCCGCATTCGAGATCACAGAGTTAAACGAACCAGCCTACGGATTTCTCCATTTCACCAGACCACGCACTGTTTCTCCAG
CAAGATCTCCACGTAGAATGGAACCAGCACAACCAAATCAATAATCGACATTGGTCGTAGCATCCACTTCAACCTACCAATGCAAACAACAGTTACTACC
CCACACCTTCAACAAGTCCGTTCGAACTCACCTTCCGCATACAGAATGTGTATATCGATCATCTTCCACGCACGACCAGAGGCGTAACGCATATTCTACC
GTGAACAGCGCCGTCGAAACATACAGGAACATTTCATACCAGTCGGACGACGTCACCGCTGCAGCAACAGATCAATATTAGCACTGTATCAATCCGCCAT
CTCTTTAACTCTTGAACACGTCAACGTACGCACAGCACCAACCGGCGAGGCCGACACGTACATGGCCAGCACCACATTGAGCGTGATGAGCACAAGCACG
CAGACCTCGAAGGCGTAGGACGCGCGCTGTAGTCCCGAGTTATGGTTGAGTGACGTGCGGTAGTGCAGCAGAGTCCAGACGTCACTACGCAGTGAGCGAC
TGCGGCGCACTTGCGGTGCTCGCCGTTTGGGTGTCAACATGGACGATGCTAGCGCATCTCGCACAGACAATTGCACGTCGATGTCGTCCTCCCGACGCAG
CAAACGCTGCTGCTCACCTCGCGTCATGGCGGACCCTTGTCAAGTGTCAATTGATCGCCTCTGCCACAATATTTCGAGCTGAAACGTGAATATTTTGAAC
GCGCGGCGAAAATTTGTCTAAAACTGTTATCAAATTTTGATTAGTCAAAACTCCCACCAATCCACTTCCACTTTACTTTCGTAACTTGGTGTTCACTTGG
TGTGGCAACAAGGGGGGCCGACAAACATTTTGTCTGTTGCGCACCGGAGACGGTGGCATGGAGAGTTACCACGGCAGCGACGGTAAGGCCGGCGGCCGCA
ACAGCGGAGCCGCCTACAAGGACCGCGGATCTTCATCCCATGGCGGACGTCCAGGAAGTGGCAACTACCAGTCGTCAGGCTCAGGCCGGGGGCTGCCTCG
ACGCGGCTCGTCCAACTCGGTAGGCAGCGCCAGAGACCGCGATCGAGACCGAGACCGAGATCGGGACCGCGACCGTGATCGAGACCGGGATCGGGACAGA
GATCGGGACCGGGATGGACGCCGACCCCGCTCACGGTCTCGAGATGCCAGTGGAAGCTCCAGAGAGCGACGCAATAGCGGAAGTCGCAGTCCTTTCGGCT
CGTCCAGCAGTCCGGCATTACGACTACGAGAGAGGAAGAACTTGCTGCTTATGCATCGAACAGGAGCCAGAAGGAACGATCTGTCGCCAGGGGATGCGGC
TACGCGTGTCATTGGCATGGACACGAAGTATATGAAGGTAGTTTTAGGGTTTGGAGGCAGAATTGATGTGTGCATTAGGGTTTAACTGACAGTGACGCTT
TGCAGGACCCGGAGCATCCGTACATTACAGACAAATTGGCCATGTTCCCGAGTGTTTTTCCTACAAACGCTAATTTTCCAGAAGAGAAGTTTCGCTTTCA
TGCGCTGCGCAATGCAGCGTTTGTGAGTCCGTTGCCACGTGGATTTAATCAGCAGTGGCATCTGCAGTATTCGGTGTTTACGGACAAAAAATTGGCCATT
TTTGATGATCTTACAAGAGCCACACGTGCGATTATGAGGTTACGTGAAGATGCTGAGGAATCAAAAAGTGGAGTGATGGAGACCTCGACACCTGCTGAAG
ATGGTGCTGCGGTTGTGGAGCGTGCGTTTACGAACTACTTGATTCGCCATGTACGGCGGCTAGATGACCGCACAAGTCATGCTTGGATGAGTGAACTAGC
GAGTGGTACTCGCAGTGTTGCGGAATTGACACAGGCGCATGGTGTACCCTTCAAGCAATGGCGCGCAGTGCCAGGGCTTTCAAAATGTCCACTTCTGGAT
TTTGTGGTGAGGTATCGGCCTGGATACGCTGACGCCACTTGGTTTGTGCGGATCAATGTAGTGTATACAGAAATGCGGGAACTTCAGCGAGACAGCGCCG
TTCGGACAGGTGACTGGTTCTTTAGTCCTCGACGCAACCTGCGGCGAAATCAAGGATGGACAGATAAACTTGTGGATTATTTACATTCGTTGGCGCGTCA
AGCGGCACTAGACACTAGCACAGGGACAGAAAACAGGTCAGCAGAGACACTAGCAAACAGATCCACGACGAATGGCATTCAGGTAGCAAGCAACAACAGT
GGGGCGACATTACATACGCCAACTACCAGTAAGGAGTCTGTACGACGTACACAAATGACTCCAAGGCTACGGCACGGAGAAGTACCAACTTCAGCAAATA
CTTCTGCTTCCGGCAACCAGGCTGCTCCTGGTAGTGGTGTTGTGGATATTTCTTCCCTGTCAACTCTATCGTGGCATGAAAAATGGTCATACGTACTGAA
GCTGTCGGAATATCAGTTCAAGATGGGGCTGCTAGATCGCGCACATTACTTTGACGGGCTTCTGTCGCTGCTGCAAAAATCCTTAACACCTCGATCACAG
CGCGGGGCAAACGGTCCTACGCAATGTTCGGCCATGCTGGGAATTGGAGTGAATAGCATCATGGAGCTGATCTCTGTGGCGCAGAAATTGCTGCCAGAGA
TACTACTTTCAGCAGATGCTGTTCTATTGCTTGTAAAAACAGTGTTGCAGCACTTGCGCTACTTGCTACCTCCGGGTCGGCCAGTACCCCCGGAGACTAC
AGGAAGCACACTTCAGGAGGAGCTTTTAGTGGCATTGTGCCAGTTGTTGCGCGATGTGTTGCTCAATGGCAACGACGTCCTCGTTCGTCTGGAAGATAAT
GGTACGTTGATGTTTCACCTTTATTAATTGATCCATTCTAATCTTTCTGTTGTTGTGCCCAGCACCTCCATTATGGCCAGCCTTTGTATTCACCAATCGG
TTCTTCAACCGCGACGCTTATGGCGATACAGCAATACAAACATGCATTGATCGTTGTCGGCGGAAAAACAAAGAGGTTGCCGGGCGCATTCTTCGCCTTC
AACAGGCGTGTCCGTCTTTGAGCTCCGTGGGTGGAGGTCAGGTACTGGCGGCTACCATGCGCAATGAGGCGCAGATCCTTCAGACACTAGACCGTTTTCA
TCGCGTAGACTCAACATCGGACTTGCATCGTGTGTATAGCGAAGTGTTTAGCCCGCTTCCAATTGTGAATCCAAGTGGTAGCGGATCCCCAGCTGAACTA
CCCGTCGATGTCGCTGCACTTTTCCTCGTGTGCGAGTGGGCTGTGACAAACCAGCGACCCGCTGAGTACCGATATTTATCAGCACTTGCGTTGATTGAGA
TGCACAGTAACACACTTCTGGAATACGGCAAAAGGTGCGTGCGTTTTGTATTCACCTGAGGCGATCAGTGTTGGATATATTCACTAACATTTGTATGTGG
TACGGTTGATTAACAGTAAGGGATTATTACCTCACTGCAGACCTAAGGATCACCAGGTGGTGCTTCAAAGCGCGTTGCAAAATTTCTTACAGCGTTACGA
ACCTAAGGTTATCACGGAGGTCACGCAAGTTATCGAGCTTTTTTGTCTCCTCGTCCGGCGTCGATTATTCAGCGTAGCCAGCTTTGTGGAGTTCGCATCA
TGTTGCAACGAAGCAGCCTCTACCATGAGCAACAGTCCATTGCTTACTTTAGCCGCTGAAGCTGGGGGTAATGCTGGCATTACTAAGAGGAAAGAATCCG
CGCTGGTTGTTCACACTGCTTACAACATCGAGTGCTCGCCTGGGCGAGGGTATAAATCTGCTGATATCCACCAGCTTTCTTCAAGCGATCGACTGAAGCT
GTATTTGTGGCAGCTCCCACGAAGTCCATTCCCGCTACCAACATGCGTGTCAATGCTCCCAGACGACAGTTATGATGGCGAACTGAATTATTTGCGCTGG
CTCGAAGTCATGGAACTCCGACGTGAACACCTCAATTATTCGAAGACTCTTGAGCGTGCTCAATCACTCTGCATCTACGTGTTTCACACGCACGGCCAGG
CTAATGATACTCCGATGGTTGGGACGCCAGGTGCCGCTGGTGCGACTCCTGCTGCTGGAAGCTCCAGCTCTGGTGACACCAACCATGTGCTGAAGGAGGT
GGAATACCAGGGCAAAGTGGGCGAGTTGGTTTCAGCTGTGAAGACGATGTGCGGTCACGATAAAGGGCGGTTCACGCGCTGGTTTTTGCACAATATTTAC
GAAGAAGCCACATTTTTCCGGTTCTCGGACTACGGCAGTGTGGAGCATATAATGCGGCTGGTGTGTCTTGTGCTTGAAATCGTGGATGTGTTGGCCCTTC
TTGAGGTACTCATACACTTTCTGCGGCGCTCCCCATGCTTCCTCGTCAAGAATGTTGTGCTGACTATGGTTGAACGCCACGAACTTGCGTTTTGTGCCAC
GGATCAAATCCCGTTCTTGTTGCAGTCATTTGTGGACCGCTTCAACTGTATCCCAAAGAACGCTGATGATAAGGCTGGCAACGTGGCGCAGTTTTTCTGT
AAAATGTACTATGCGCATATTAAGAAGAAAGAGATCGCCAAACTGGACTTGCCGTTTGCACTGCTCAAGCCTATTGCTGAAACTGCTAGGAAGAACCAAG
ATGCAGCTGCAGCAGGAGGTAGCGTGAATGGTACAAGCACCAATGCGAATGCCAATGGGGCGAACGGGAACCAAAAGAAAGAACTGTCGCTGGAGGCTAC
GAACCCAATCGTGCGTATCCCACCACCCCGCGAGGTTCTACCTCCGGAGCTAAAGAGCGCACTAGCCAGGTCGTTTAAAGCATTACAGGCGCGTTCCTTT
GATGGTCCTGGTGCTGATGGCAAACAAACGCCGGCAACACCTGGTGCTGGAAACAGCACCCCGTTACAGAGTCCTAATAGCATGAGCCAAGATGCCTCAA
CATCTACTGATTCTGTGGCATCCTTCGAGCCCAGCTATGCGAGTTTATCGTGGCAAGAGGTTGTTGGTGAAGCAACCCCTGCAGCAGAAGCTAAGTGTCG
CGATAGTGCTATCGACTTTGCGGTAGCCACAATCAACATGAGCATGACGTCCTCTTCTGTGGGGTCTACAAATGCAAATGCTACACGGGAGCGGCGCACG
CCTAACTACGTGTTCTTCTTCCGAGCTGTACTGAGCGAGGCTATGGACAAGTGGATGGCCAATATTTCGGCACGTGCGAAGGCAAACTGCAAGCGCCCCA
TCACAACCCCGCATTATGTGCACCGTTGTGTGCGCATTATTCGGGAAGTTGTGGAACAGCATCCTGACAACGGCGAGGAATTCAACGAGAAATTCTCCAA
CACACTGGTAGTGTGGTTACAAAAGGAAGTATTGCCTGGTTTTGCTGGCAGTGATACGCCAAAGCGCTCGCGGAATCCGTTCTTGAATGCTGACAATAGT
AAAGAAGCTTTCACCCTCAACCAGAAAGGCCGTCTGGACCGCCTGCAGTACGGACTCAAGAGTTTTCTGGTGTCCTTGGTTGTGCATAAAGTGCTAGATC
TCTCCCAGGTGCTCAGACTGGTGCTCGTACCGCTCTTCCCGCGACTGGTATCGTTTGTGACTGTTTACCTCTTGCTTATAGTATTCTATTAGTGACTAAC
TTGACACTCGTCACTTGTTGTGTTGTGATACTAGCGCCGTGCATCGCGTGACCCACCGCCAAACTTGCCAACACAGCTTTTGGCTATGGCTCTCGTCTTT
CAGCTCTTTTCTGAACCTCCACAGAATTTGCTACTTGAACCGCAAAAGTTAGTTATGTTCGACGAACCTTTGGTGAGTTGTAATTGGAATACGCAATCCA
TCTGCGAACATTACTGACCAACTATGTCCGTTACGGCAATACAGACGAAATATCACCTGCGTTTCCTGCGCACACAGGTGCCAGCATGCTTGATGTTCCC
GCTGTGCTTCCTGCTGTGTCAGATCTCATATCAGATGGAGGACAATTTCCTACTTCGCAAACGTGAGGAGCGTGGCAATCTAGCTAGCGCCACACTATTC
AACTTGACGTCAGACGGCATTGTTCGAGACACGATCTTCCATGATACCAAAGAAGCTCGTGAAAAGCACATTCTTCCAGTTTACCACAAGAAACAGTGGC
ATACAGCCGTTCTGTTGACACATTTTTTCCGTCCACCTTCGTCGCCGGCAGAGGACGGTAATGGACAGGTACAATTGCTCAAGGTAGGTCAAATTATCGA
TCAGATGAACGTCTGGACACTTCATCGCGGAGGTTCAATCTACCTGGATTTGCAAATGAGTCGGCAACAGCAGAAGGTGAAGCGATCTAAACGAAGCTCA
CATCACCAAACACCGCAACAACCGGCAGGGACCAACAAACGAAAAGCACCCCAAGGAGAACTGTCTACACGTTCTAGCAAACGAGTAGCTGTGGATAGTG
GTGATGGAACTGTCGCAGCTGCAGTCAACGGGTTTGCCGACGGCAAAGCGTCTCTTAGTTGCCAAACTGATAAAGAGGTATCATTTGGTGGTAGTTTACT
CAGCAGCAACTTTTCAGATGGAGAAGAAGACACCGACGAAGACGATCTTGAGCTCGAGTTGGGATATGACGAGTCGAGTAGCGCCACCGAAATTTTGTCG
AGTCTGATCGTACTACGCACCCTTAAACGCAGTTCGCGACCGCTTCCGGGTGTAGGATCGACTTCGTTGTCCTCATCCTCTTCGACGTCGTCATCCGTGC
CCCAGACGACATCTGCAACGATTACTACGCTCTCGTCGTCGTCACCTCTTGCTACGCCAAAGCTATATGGTACGCCGCATCATGTTCATGGAGACGGAAG
CGATGGCAAACACCGTGGGGGCACACCAGGTCTAAATGACCCCTTAAAGAGGAAAGTACCAACACCGGCGCTACCAATGACTGTTGCGGCAATGCAAAAC
TCGTTGACTCCGTGTGAAGCTCGTATGTTGGAGGCAGCCCGAGAGGCTCAAGACTCGGCAGTGGCATCTCTATATGCTGCCACAGTGTGCAGCATCTCGA
GGCGCGCCATGGGATCGGTGATTGCCAAGATATTGCAGATTCTGGAGGATGACGTCAAACACACACAATCTGACAAGTTTGCGCGGCAATTGAACACAAC
CTCTGTTGTACATCTCGTAAGTGGTATCATGTGTACACCACCGGGTAACGCTTTTTTGCCGCGCTACATGATGTCGCTGGCTACTCAACTCGAGTGGCTG
TACGAAGGCTGTGCCCATTACGACAAGCAACTACAGTCAGCATCTGCTGATCCTAGTCAACGCAACAGCCTTTTCCAGCGCCGGCTTCGCTGCAAGTTGG
CTGTGCGACTACAGCTAGTGGGCGTGATCGGAACGAACAAGCATGCTGTTTTGACTATTTGCTATCGTGACCGCATCGTGAAGACACTTTTTGCGTTGCT
TGGAACGTCGGTAGTCACTACTGGTCCAGGGCTTTCGCTCTTCAGCTGGATTCTTGACCTCATTCCGATTGTCAACGCCTCCGTTCTCCACGACAGGCAA
TTCGTAAGTATCCCTGGCGCTGTTGCCTTGTGTATAATGTTTATCGACTGACATACTTTTTGTGCAACTATTTCAGGAACTTGTGGAAGCACTACAGCTC
CCTGATGAACTAAAGCGGCGTGTTAGATCTGTTCTACCCCGTCCGATGAACATGTTCGTAGCAGCGAATGTGTTTGTGGGTTGCATTGTGAGACCAGCGC
AAAGCAATACTGATACGAAGGAGAACCCAGAATACGCACCCGTAGACCCATGGGGCTTGCTGGAACATGTGCCGCAGCTACCTAGCGATGCTCTTGTTCC
AGCGTTACCTAGCCAGATTCCAAAGCGGCCCCGTCGAGTGTTCCGGTGCGTGTG