Transcript Name :
Phyli_Pl_104880
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_483739
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
WD40-repeat-containing domain18.246PS50294
WD40 repeat11.11PS50082
WD40 repeat13.984PS50082
HmmSmart predictionP-Valprediction_id
WD40 repeat0.0043SM00320
WD40 repeat220SM00320
WD40 repeat0.00000022SM00320
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-191
NN-scoreoddsWeighted Score
0.8862.180.004
*** None ***
TypeScore
nuclear73.9
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        575 bases(100 bases per row)
TGTGGTCTCCTGATGGCAGCACGTTGGCGTCCGGTGGCAGTGACAAGTATTTGTGTCTCTGGGACCATGTATTGACACGGGTGAATCGGTTGAATAACAT
CTCTTCTCCACGATCGGCTCATCTCGAACATTGCGCTGCTGTGCGGGCCCTTGCATGGAGTCCATGTGAACGAAATATCTTGGCATCGGGCGGAGGGACT
GCGGACAGCACGATCAAACTCTGGAGCACGTCGAATGGCCAAATGCTGCGTTCTGTGGACGCAGGATCACAGGTGTGCGCATTGGTCTGGTCTACCACAA
CGCAAGAGCTGGTGTCAGCTCACGGACATTGTTCCGCAAGCAATCAGCTCACACTGTGGAGGTATCCAATGATGAAACAGGCTCGCCAGCTCACGGGGCA
TACTGCACGAGTCTTACACCTCGCAATATCTCCAAGTGGCTCTAACGTGGCCTCGGCCGGAGCTGACGAAACGCTGCGGTTCTGGAATGTGTTCCAGGCG
TCGGTATCGCCGTGCGCTTCTCGAATCGATCGATCAGGCAACCGATTCAGCCTGTCGACCGCTGTTATCCGCTAA