Transcript Name :
Phyli_Pl_100626
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_333561
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-570
NN-scoreoddsWeighted Score
0.7261.2280.002
*** None ***
TypeScore
endoplasmic reticulum44.4
GO
*** None ***
*** None ***
*** None ***
Sequence
        1712 bases(100 bases per row)
ATGGTGAACTGGTCGAACTTTCTAGCGGTCTTAGCTGTTTTGAGCACTGTTGATGGATCAGTCGAACGGTCCACTACAGCTTTAAGGGAATCAAGCGCTA
CAAACAGCACAAATGAGTCAACCACTTCGCTTTCACGGACACAAGATTCAACGATTATATTATCCTCATTACACAGGGGTCTTCGAATCGAACCCCACGT
CACGACAATCGACACGGTCGAGTCTACCTACCGGAATTGGGTCGGCCCTACCATCGGCCAACCGGATCGTGGTGATTCTGCCTGTTATCGGAGAGCACAC
ATCATGAATAAGTGCCCCATTGGCTTTGACTACAAGTGGAAGACGTGCTGGACGCAGTGTCCGCTCTCGTATCCTGTGGAGTGCGGGATGGAATGTATTC
GCCAAAATGACAACTGCGCACTCGAAGTCTACGCTAAGACAGTCAACGTAGTTCAGACAGCAATATCGCTGGCTACAATGGGTCTGTTTGGTGAGCTCAC
ATTAGCGGTGAAGGGCGTCGTTGCAGGTGCCAAGTGCATCCGATCCATGATCGGCACAATTAAGATGCTCATCAACTACATTCGTGGTCTTAAAGTGTAC
GACCCCCAAATTCCCTACGATCGAATCATGGCTCTGTTGTACCAAACGAGTTACATTACAATTGATTTCCCGGTCACCATCGCGATGTGCTTGGGTCACT
CGTATCCCGAAGTTCTAGATCCAGCAAGTTGGATGGTAGACACAATTCAATTGCAACTTGGAGAGATCCTTGACAATGGCGACAGCATCATCCGAGGTTG
GGACCGGTTCAAAGCTTTTCTTCATCGAGTAAACTTTACTCAACCTTTGTCGGAGCTGAATGAGACTGATATCTCGTCACTCAAGACTGGTTTAGCATCA
AATTCGACGTGCGGATACGAGCTGAAGCGGATCACAGATCGGACTTGGATGACCGTGGCTCAAATGAAGAGAATGAACCCCGGAATCACCCAAGACGAAC
TCCGTATTGCGATTTACGGATCGGATCTCATGGTTCATGACATTCCGACAGTAACCAACAATTGCATGGAGCAGATGATTTCCGAGTCAACGGAGGCTAC
AGCTTATCAAACACGAGATACACTCCGCAAAACACTTGGGGTGATTGTGGACGATCTCATCGATAAAGGAACCAGTGATAATGGCACATCCTTGACAGCA
AAAGAGTACACACGTGTCGTGGCAGATAAACTCGCCATGACTATCTTCGTTCTCTCAATTATCGACGAGACTCGAATCATAGGTGTAATCACCGAGTACA
TCCAGCCGATCTGCGGGCCAACCCAATTCATCGGTGAGATCGATGACGGCACTGATCCTTACACACTTGGACTCAATGCTGTTGGAAAAGCGTTCCGTGA
CAGCAGTTTATCCTGGATGAGAAAAGGTGACGGAGTCGTCACAATAGTTTTCGAGAGTCTCGACACAAAACCTGTTACTGTGAACATTTTCTCCGGTGGT
GACAAGATCGGTGAGAAGGACGTCTTACCAGGTGGAAACGCCACGTGGACATCGAATGTGACGGTACTAGGTGGGAAAACACTCTACCTTGATCGATGGA
GACCAGGGTTTCTGGGTCTTCCTGGCACAGGTGGTGGCTCACTCAAGCTCTGGATTCCAAAGGCCAGCGAAGGTGGTCACTTGGACCTTTCCGTCAAAAT
CAATGTTAGTTA