Transcript Name :
Phyli_Pl_113112
Orientation:
(-)
Number of Exons:
13
Description :
hypothetical protein PHYSODRAFT_309120
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Cell division protein FtsZ0PR00423
Cell division protein FtsZ0PR00423
Cell division protein FtsZ0PR00423
Cell division protein FtsZ0PR00423
*** None ***
HmmSmart predictionP-Valprediction_id
Tubulin/FtsZ, GTPase domain0SM00864
Tubulin/FtsZ, 2-layer sandwich domain0SM00865
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Tubulin/FtsZ, GTPase domainIPR003008
*** None ***
InsideOutsideTMhelix
1-526
*** None ***
PositionContextScore
442GDNRALR|AA0.552
*** None ***
GO
Biological ProcessGO IDPrediction Method
GTP bindingGO:0005525IEA
GTPase activityGO:0003924IEA
cytoplasmGO:0005737IEA
*** None ***
*** None ***
Sequence
        2570 bases(100 bases per row)
TGGTGCACTACACGTTGGCGGGACGAGTAAGCAGCGATGAATATGCCATTTGCGATCGGTTGCTTGGTACGAAGCAAGTTGCATGCTATTTTACCAGTAG
AATTCCTCTGACGACTGCACCGATGCAGACATTCTAGCGGCGACTTTGCCCGACTGCCAAGTGACGAAGCAACCATCCAAGACCGACCACTGGCCCAACG
ATGCCGCAGAGTTGATGCGTCTGCATGGGTTAGTCTTTCTTGTCCAATAGTTTGCGTGTTGTTTGCTAACCTTCGAGACAGCTTCAACTTGCCTACGTCT
TCAAACCTCGTCATCTGTGATGTGGCGATCTGGACCGACACAGGGCGGCTTCTGTGCTCGGATGTCGATGCCTTCAGCACGTTTGTGGGACGCAACTACG
GCATCCAACTTGATCTGACAGAGGCAGAAGTGCTGCTGTACATCAAAGCCAACGTCGAGGAACTGCGCCAGCAAACGTAGCTGCCTCTAATAAGAAACTG
TTCGTGAAACTTCATATTCTAACTGAACATTTCGAATACAAATCTGAATTCTAGTCACATATTTTGTGGCGATCCATCCCCAATGGCGATTTCCCGCATG
AAGGCCGCGACTACAGCGCTGCTGCGTGCACGCCAGGCCTCCCAGGTCGCTACTCCGTGCTTCGCTTTCTCGACGGAAGCAACAGACGCTGCGGCTGCTG
CGTTACGCATGGTAAAAAGCCGCAACACCAAGGAGAATACGTTAAAACCATCCTTTGACTTGGTTGTTTACTGTTTGCAGGGCTTTAAGAAGTCGAAAAA
GGACGAGGACGACACGATCAAAGTGGAGGTGGAAGCAGACTCAGTGTCACCGACGGATGTGACCGCAGTTTCACCTCCTGTAGTGGAGAAGAAGCTTATG
CCGCCCGCAGTGAGCTCCACCCAGCCGCTCTGGCTCACGCAGGACCACCCCACGACGGATTTGTCAGGCTTTGCACCGAAGATTGTGGTGGTTGGTGTTG
GTGGTGCTGGAGGCAATGCTGGTGTGTGGACTGTAATGATAGGCTGCGTGAAATGAGATTCAGCTGATTGTGGTTTTGATGTTTGATTGGCAGTGAACAA
CATGATTGCGCGAGGTCTACAGGGCGTCGAGTTTCTGGTTTGCAACACGGACGCTCAACACTTGCGCACGACATTGACGGAGAACCGCGTTCAAATGGCT
CCTGAACTGACTGGAGGACTGGGATGTGGTGCCAACCCCGAAGTTGGGTGAGTTGCATGTCGTGTATCTGTGGTTTGGCAAGCCATGAAGGATCTGATGC
GGCGAACTATTATGGACGTCATTACTGTTGTGTTTATCAGTCGTGAAGCTGCAGAGGCTGCGATCGAAGAGATTCTGGAACGGGTCCAGGGTGCAAACAT
GGTGCGTTGCATTGGTATTTCTAGTATTTCTAGTATTCTACAGTGCTTGTGCTGAAGCGAACTAGAGTCTTTGTAGCTTCAGCTTTACTCACTCCTCTTT
TATTTGCTATTTGTAGATGTTTGTTACTGCTGGTATGGGCGGTGGAACTGGCACGGGTGCAGCTCCTGTCATTGCTCAAGCAGCCCTGGATGCTGGTATC
CTTACCGTAGCAGTCGTCACCAAGGTGGGTGGGTATACATAGTTCTCTTGTACCAGCTATCTTGTTAACAAGTGGACGTATGAACTGCAGCCATTCCGTT
TCGAAGGTAACAACCGCGCGAAGCTTGCGGCACAGGGACTGACCGAGCTAAAGGATAGCGTGGACACGATGCTCGTAATCCCAAACCAGAATTTGTTCAA
CATGTCAAACGAGCGTACATCATTGATGGATGCATTCCGGTACGGAGCTATTACCCGCTTTGCTCGCTTGATCGGGTCGAGTGATTCTAATGATTGTTAA
TGCGTAGAATGGCGGACAATGTACTTCTTGACGGTGTCAAGAATATCTCCGACCTAATGGTGATGCCAGGGCTGATTAACCTTGACTTTGCGGATGTTCA
ATCGGTACGCAGCCCTTTCAGTAAATGCTCGGTATAATATTCCTGTCAAACATTAACGTGTTTATGATTCGTAACCACAGGTAATGCAAAACATGGGAAA
CGCGATGATGGGAAGTGGAGAGGCAGATGGAGACAACAGGTGAGACTAGCTAAACTTGATGAGCTTTTCACGACATGACACAGATCGATTAACGGTAATT
TATGCGGTTATCTATTAGGGCATTACGTGCTGCAGAGGATGCGCTGGCAAATCCTCTTCTGGGAGATATTTCGATCAAGGTTCGTTTCACTTTCTCCAGT
AATTGCAACCACCACACAACCACAGTATTAACGATTTTCCCTTGGTTTCTTTTTCCCGACGTGCAGGATGCCAAGGGAATGATCGTAAATATCACGGGCG
GCTCTGATCTGACGCTGTTTGAAGTCGACGAAGCTGCGGAACGTGTGACGAGGGAACTTGATGACCCACACGCCAACATTATCTTCGGTTCGACATTTGA
TGATTCCCTCGACGGCAAACTACGTGTCTCCGTTGTAGCTACAGGTATCGCCGACCCCGAAAAGTTATAG