Transcript Name :
Phyli_Pl_113117
Orientation:
(+)
Number of Exons:
2
Description :
hypothetical protein PHYSODRAFT_343761
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1028
NN-scoreoddsWeighted Score
0.5751.4880.003
PositionContextScore
28SSPRVRR|RA0.647
71ALLRAKR|AF0.607
TypeScore
cytoplasmic56.5
GO
*** None ***
*** None ***
*** None ***
Sequence
        3183 bases(100 bases per row)
ATGGAGGTAGCCGTTGTGTCGGAAGCTGTGTCTGAGGCGCTGCACCAACTGTACAGTCCTCTGAGCTCTCCGCGTGTACGACGACGTGCTGATTCCTTGC
TGCAGCAGTTCCAGCGCTCCCCCGAAGCTGCGCAGACAGCGTTGGCTGTGCTGCAGACACCAATTGTCGATACAGGCAATGCGGAACACAATGCGTTGCT
GCGAGCCAAACGCGCGTTCTCTGCGTCGACAATCTACTTTACTGTGGCCTCGTACATCCGCAAGTACAAGATGGACGACCAAGCCAACTGGACGCCCGAG
GATCGGGCACAACACGAGCTTCTTGTGAAGGATTTCGGATTGATGGCACAGAATGTTTGGAATGTGCTGACTGGGCCTAATGGTACTCAAGAGGAGCTGA
ATGTGCAGACCCACTTGGCTCTTACGGTTGCAGTAATCTTACTACGTTTTCATGAGGTACAAGGTGAGACTACTGTTGTTGGCGCGGTGGAATGGCTCGT
GCAGAACCAACAACACCCAGTTAGTGACGGGGTAACAGCTACATTGACCAACTTCGCTGTGCTCCTCACGCTGAAAGTTATCCCAGAGGAAGTGGACAAC
AAACGAGTCAAGTTTTCTAAAATGAAACGCGTGCAGTGTGAGGACATGGTGCAGCAGTGTGCAGCACATGTGATTCGTAGTGTTCTGCCGTCAATCGCCT
CCGCAATTGATGCTAACAAGGAGCAGACTCACCTGCGTGGCCTACTGTTACAAACATTTGCGACCTGGGTCGAGCATGGTACAGTACCACCGCAAGTTAT
CATTGAGTGCGGGTTGCTGGGCCGAGCTTTCCGTGAAACGCTGCTTCCGGTATCCTCGGTGTACGCCTTACAAGGAGTGCGTGAAGTGGTGCGTGCATGT
CGTCACGACGAACACGTGCAGCTGATGGAGCTTGTGATGCACAATTTTGTGGTGCTAGGAAAGCAAATTCAAGAACGCATAGCAGCATCTGAGAAGAGCG
TGGACTTTTACCTTGCCGACTGCGCTAGAGCGATATCGGAATGCGGTCAAGCCTTTATCGTTTATTTTGTGGACTATGCACTGGATATGCGACCTGGTTC
CTTGGTGTATGAATTCCTGGACACAATTCTTTTCTTCACGTCACTGAACAATCTCGATATTTCGAATGAAACGATGGAATTCTGGATTGACTTCCGCGCA
TACATATCGGGCAAGCATGAGCAGCGCATGTACGTATTTGAAACATTCATATCGCGTTTATTGATCATTTTGATTGAGCGAACCCAGTATCCAGAGGGGT
TTGAAGCTTTCCCGGAGGCTGCCAAGGAGCGCTTCTCTGTGTATCGTAGTGAAGTTCGCAACGTATTCCGCGCACTTGCTACGGTCACAGTTGCCAGTGA
GGATAAGTTTATTGTAGATGCTATTTATGCGATCTTCCAGCAATATGAAGCCGCTGATTCGGGAGCTCCTTTACCGCCGAATGTACGTGCGGATTGAGTG
GTGGTGAATTGTATCTGTTGTGTTGACAAAACTAACGGGACCTCTGTTTGTTGTAAATTTATTTAGTGGTGGCAACGAAACAGAAGTATATGTACACGCT
CTTAGTGCATTATCAAAATCGATTCGCGAGGAAGATACATCTCTCGTTCCAAGACTATTCGAATATTTGTCGCGAAAGGAACCTTCTCACCGCGCACTCT
TGCGCACAGTTACCATCTTCCTTGGTGTGGCCGGCCATTGGTTTGCGAGACACCCTGAGTACTTGTCGACCTGCGCGTTCCAAATTATTTCCAATGGCCT
CGAGCTCTCCCAGGATGACCCTGGATATCCTTTCACTCAGCACGGCCTAGAAGATCATGTAGGTGCTGTGGCACTCCGAAAATTGACGCTTCGATGTGGC
ACGTACTTCTTCAATCCGCTGTGGATGGATGCGTTGGTTAATTTGTACCGCTCGAATCGTGCGGGTGTGGGCGTGTCGTCGGGACCCTGCTTGACAGGAA
ATAGTGCGAAGCTTATCGTCGACTCTATTTGCCATGTCCTCACCACGGTATCGTACAAGGATGCGCTGCCTGTCGTTGAGGAACTCGGGACTATCATGTT
TGCAGACCTTGCGTCGCGATATAGCCAGCTAAATGCGGATGACGAAGGCTCTGTAGAGTTATTGTGCGAGATATTCAATCATCTTCTCGTGTTAGCCACG
AGGATTCCTATGCAGATGGACCAAGAAACCCCGCATCCAGTTCTCTGTGTGTTGCAAAAACAATGGGGAGTGATGGAGACTATTTTACGCGTGTATGGCT
GCTGTGATGAAGTGATTGAGCCGTTCTGCGCGCTTCTTGTAGGTGTCTTTGAATCTTTGCGGACTCAGGCGCTGGAGTTAGCATCTGCGATCATGCCAGC
GTTGCTGGAACAGTTTTCGCGGAGTCATGACGGTAGTTATCTAAGTGTGATCAAAAGCATCATTGTCTGCGCTGGTGACGACGAAGCTACAGCAGTTAGC
TTAACACGCGTGATGGGCATTGTGAGCGAGAGTTCCATGAGCAAGATCGCCGCAGACGGCAGTGTCGATGAACATCCGGGCCTTACCATTGCTCTATTTT
CTTTAGTGGCAACCTGCGGCATGCACCACCCGTCGATTTTAGTCCAGTCGAATCAGTTGGAAGGTGTGCTTGCCCTAGCACTCCACGCTTTTAAGTCGCA
AAATCCTGAAGTCGGAGCTGCGACTCTCGACTTTCTGCTTGAGATAGGCTCTTTGTACGGCCAGATCCTTCGTACCCCGGAATGCTTGCTCCATGGACCT
GAGTTTGCAGGCAAGTTACTGCTTCACCAACAAATCCAAACTCTTTTCTTTGAGAAGGACGTGCAGTACCACTTACTCTTCGCACTGTTCAATGCCGCTG
CCGGTGGCATGTCACCGACCTTGATGGAGAAGATAGCCGAGGTCGTTCGGTCTTGCTGGGTCTACTTCGGACGTCAGCGCAGTGAAGAACTCATCCATCG
GCTTCTGTCCGACAGCAACTTTTTGGGCTCACAGGTCAGCGAGCGCGCTAAAACTGAGTTCATCAAATACATTTCCACGCCGACTTGCGTGGAAGACTCA
CGCAAGTTTAAACGCGTACTGAACGCGTTTTGCTACCACTTTAAGCGCAATCTTAGTGCGAATGGGGATGCGATGGCTTCGTA