Transcript Name :
Phyli_Pl_113118
Orientation:
(-)
Number of Exons:
5
Description :
hypothetical protein PHYSODRAFT_248383
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Glucose/ribitol dehydrogenase0.00000024PR00081
Glucose/ribitol dehydrogenase0.00000024PR00081
Glucose/ribitol dehydrogenase0.00000024PR00081
Glucose/ribitol dehydrogenase0.00000024PR00081
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Glucose/ribitol dehydrogenaseIPR002347
*** None ***
InsideOutsideTMhelix
1-235
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        986 bases(100 bases per row)
TGTCAAAGAAGCTGCTCGTCGTTGGCGGCGCCGGTGCTCTAGGCCGAGGCGTAGTGAACCACTTCACTCGTGCATCTTGGGGCGTCACTTCGGTGGGGTT
CTCTGCGAACGAGGACGCTGAAAACAACGTGTTACTTCCCAAGAGCAATTCACTCAGGCAGGCAGAACAAACTCTGCAGGAAATCTCGAGCAGGTGACAA
CACTTTGTTGGGTTGCAATTGTTGCAGTAAGAACTAACTTACTGATAGGTATGGCAAGATGAACACAGTGGTGTGCACTGCTGGGGGCTGGGCAGGTGGC
AGTATCCGCGACGCGGACTCGCTCGTGAACTTGGGAGACATGCACAGCAAGAACCTTGAGTCGGCTTTCCTAGGTGAGAGCTGCAGATTGTGGAATTTTA
AGTTTATTTCTAATGGAATAATATTTTATCTGTGTAGCGACGTATCTGGCGAGTCACTTGTTGGTGCCTGGAGGACTTCTCGTTCTCACTGGTGCAACTG
CTGCACTTGAGGCAACTCCAGGCATGGTGTCCTATGGAGCAACCAAGGCGGCTACTCATCACTTGATTGCCAGTACTGTGTAAGGCTTTGAGAAGATTGT
TGTGATCCGAGAAAAACGATGGTACGCTGATGATGCTTTTGTATTTGTTGCTTATTACACATTTAGGACTGAGTTACCCGAAGGTTCGTCGGTACTGGGC
GTTTTACCAACGACGATTGACACTCCGATGAATCGCCAGTTCATGGCTGACGCTGACTTCTCCACGTGGACTAAGGTACGTGATTGATATCATTGTTTGC
GACTCCGACCACGACCTCATGCACACAACAACGTGATTCAATTCATAGACAGAAGATATTGCTGAGAAGATTTTGGAGTGGTCCAGCGCTTCTTTTGCTG
ATCGCCCCCCTAGTGGACATTTGGTCACTGCCACTACAGAGAACAATACGACTTCCTGGAAGGATGTTGGCAACCCGTTTCAGTAG