Transcript Name :
Phyli_Pl_113125
Orientation:
(-)
Number of Exons:
2
Description :
hypothetical protein PHYSODRAFT_477864
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-217
218-235
236-247
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        808 bases(100 bases per row)
TGGAAAAAGTCGGCTGCATGGCTCCCGGTATCCGTTACCACGAGAAGAACGCGGCGTTCAGTCCGTCGCTCAATATGTCTCGTGCCAAGATGACGTACAC
GCAGGCGGATCAACAGTTTACCATCCTAATTGACGCTGATGCCTCGGGCAATTGGGTCAAGTGCTACAGCCAGCGTCTGAACATCGGCGACCAGTGGATG
AACGACGCATACGTCGGTATCTCGGCCTCCACGGGTGGACTTGCTGACAACCACGATGTTGTTGCACTCAATATCTACGAGTACGTCTTGTTATTGGGTG
GGAAATTGGGAGGTGAACTTACCTTTTTCTTTTGATGTTTTGTAGTGACGTGATTGACTCGCTCGCGGCCCAGGAAGATGAGAAGCAGCGCAATGCGGTG
GATAAGAAACTTGAAGATACACTCAGCAAGGGCAACAACGACGACAAGATGAAGTTGGTTAAAAAGAAGTACGCTCAGTTGCTCGAGGAGTTTGAGTACC
AGTTCACTGCGTTGAAGGAGTCGACGGAAAACACGATCCAGAAGCTGAAAGAACAGGGTGCTGAGGACGAGAAGCGTATTGCTGAACTTGAGGCTTGGGC
AAACGGAAAGGTGGTGGAGCGTGTGCACAGCACGGTGAACGCTATTCGTGATCAGGTGGATTCGCAGTTGACAGAGACCGTAAAGGAAACGGCTGCCAAG
TCTAGTAGCTGGAAGACTCCGTTCTTCATCATTGTGTTCATCATTGCTGGCATTGTGGCTGCCGGTTACAAGAAGTACCAGGACCTGCGCAAGACGCACT
TCCTGTAG