Transcript Name :
Phyli_Pl_113147
Orientation:
(-)
Number of Exons:
3
Description :
hypothetical protein PHYSODRAFT_551993
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
GTP binding domain7.82e-28PR00326
GTP binding domain7.82e-28PR00326
GTP binding domain7.82e-28PR00326
GTP binding domain7.82e-28PR00326
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-390
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
GTP bindingGO:0005525IEA
*** None ***
*** None ***
Sequence
        1306 bases(100 bases per row)
TGCCGCCGAAGGGAAAGAAGACCGAAGAGGTAACACGTACACTACCCACACCACAACACTCTCTCTAACTTGATGCTCTCCCTCTCCGACAGCCCACGCG
CACGTACCTGGGTCGTCCCGGTAACAACGTCAAGATTGGCATTGTGGGTGTTCCTAACGTGGGCAAGAGCACCTTCTTCAACTGCCTGTCGAAGCTGCAC
ATCCCGGCCGAGAACTTCCCCTTCTGCACCATCGACCCCAACGACGCCGTGGTGCCGCTACCGGACCAGCGTTTCAACTGGCTCGTGGACAAGTACCAAC
CCGCTAGCGTCGTGCCGCCTGTGATCTCCATCACGGACATTGCCGGTCTCGTGCGTGGTGCTGCTGAGGGAGCTGGTCTGGGTAATGCTTTCTTGTCGCA
CATTCAGGCCGTGGACGCCATCTACCACATGGTGCGCGCCTTCGACTCGACCGAGGTGACCCACGTGGAGGGCAACGTGGACCCTGTGCGTGACATGAAG
ATCATTCAGGAGGAGCTGCGTCTCAAGGACATTGAGCGTGTCAAGAAGGAGTCGGCCGGTGTCAAGAAGCTCGCAGAGCGTGGTGTCGGAGGCAAGGAGA
AGAAGCTCGAGTACGAGGCTCTGTGCAAGATCCAGGAGTGGCTCGAGTCGGGCAAGGACGTGTCCTTTGGCACGTGGACCGCCCAGGAGGTCGAGATCCT
CAACACTATGCAGTTGCTGACTGCCAAACCCGTTGTGTACCTGATCAATGTGAGCAAGCGCGACTACCTGCGCAAGGGCAACAAGTACCTGCCTAAAATT
GCCGAGTACATTAAGGAACGTGGTGGCAACGAGCCAGTGATTCCTCTGAGTTGCGAGTTCGAGCTTGAGCTGCTCGACCTCGAGGCTGCTGGTCAGCTGG
ACACGTACTTCAAGGAGAACCCGACGCACAAGTCGATCCTGAACCGCGTGCTCCGTATGGGTTACCAGGCTCTTGGCCTGATCCACTTCTTCACGGCCGG
AAAGGACGAGGTGCGTGGTTGGACCATTCGTAAGGGCCGAATGGCACCCCAGGCTGCTGGTGTGATCCACACGGACTTCGAGAAGGGCTTCATCATGGCC
GAAGTCCAGGCGTTCGCTGACCTGAAAGAGTGTAAGTTTACTTGTGACGATACTCTTATTTCTGCTGTGAGCTTCCACTAATGATGGTATGTTGTTTTGT
AGTGGGTTCGGAGGAGGCCGTTAAGAAGGCGGGTAAGCTCAAACAGCAGGGCAAGAAGTACGAGGTCCAGGACGGCGACATTATTTTCTTCAAGTTCAAC
AACTAG