Transcript Name :
Phyli_Pl_113121
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_466632
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Cytochrome b245, heavy chain0.000076PR00466
Cytochrome b245, heavy chain0.000076PR00466
Profile scan predictionP-Valprediction_id
EF-hand domain7.512PS50222
EF-hand domain8.851PS50222
Ferredoxin reductase-type FAD-binding domain12.064PS51384
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-305
306-328
329-342
343-365
366-384
385-407
408-448
449-471
472-477
478-497
498-501
502-521
522-825
*** None ***
PositionContextScore
53RRSRRRR|AN0.766
*** None ***
GO
Biological ProcessGO IDPrediction Method
oxidoreductase activityGO:0016491IEA
calcium ion bindingGO:0005509IEA
membraneGO:0016020IEA
*** None ***
*** None ***
Sequence
        2477 bases(100 bases per row)
TGATGACTACTATGGTCAACATGAACCAGAATCCTCCACTTCGAAAACCAGCGGCGACTAATTTCATGGACAGCAGCAAATTCATGTCGATGAATTCGAC
CACGACCCACGCGGTTGGTAATTGCAAGAACAACAACCGTCGCTCGCGTCGTCGTCGTGCCAATGTGGACGCAATGATGCGTTCGAACATGGTCCGTCAG
AGTTTGACATTGTCAGCATCAAGTGTATCGTCGACCTCTGATGTGGCTCGTAAGAAGTGTCGTGTTGCACCACCTGCAGACAAGAACGACATGTACGGCC
CACCTCCTGGAAGTGACGTTGTGACGGTGCCAATCCCTGGTGACTGCAACTTCGAGCAGAAGTACAATGTGGCCATGAGTATGGATGAGAAGGCGTTCAC
ACCGATGGAGAAACTCGAGGCGCTTCGTGACGCGATGGGCAACTTCACTGACAAAGATGGTTACATTGAACGCGAGACCTTTTCACAGGCCTTTGAAGTG
GACGGCAATGAATTCGACGGCTATGCCACCAGCACCGGCACGATCGATGGTAATGCCATCCTGATTGACGCTGTGATGAAGCTTGGGGTGAATGCCCAGG
AGAAGTTACGCTTCATCTTCGATACACTGGACCCTGACAACACTGGATACGTAGTTGAGGAGCAGATCGTACAGCTACTTGAGTCGAACTTCTCTAGTGC
CAAGATTGATGTAGTGGGCATGGAATTCAGGACAGTGGCCAAGCTCATGTTCCGCAAGGCTCGTGTTCAAAACGATGCTATGACGTTTGAGCAGTTCTGC
AGAGTGTTCGAGCCGTACGTGACGGACTCTTATCACCTCGAAGAAGCGAAGCCCGTGTACTCAGCACCCATTCGTCCCAAGAGCAAGTTTGGTCAGTGGT
ACAGCGACAACAAGCTCCGCATTTGGTGGCTGTTCTTCTATTTCATCGTGAACAACATCGCCTTCTGGGTCAAATGGTTCATGTACGAGGTCGATCCGGC
TATCGGTTGGGGCCTTCGAATTGCCCGCGCCAATGCACAAGTTGCCATGCTGAACTGTGTCTTCGTGTTGCTTCCCATGTGCCGCTCCATCACTCAGGTG
ATGAAGCGCAGTAAATTTTTGTGGCGTATTATCCCATTTGACGATCACATTGCATTCCACAAGATCTCGGGGAGTGTGCTGCTTATCGCCGGTCTCATTC
ATACGATTGCTCACGTTTTCAACGAGATCTACTTGTATCTGATCGCCACTCCGGACGAAGTGAAGCGCTCCATTTTTGTGACTCGCCACGTTTCGACCTT
TGTTAACGGTGAACGTCCTCCGTTCACTACAATGTTGCAAGCTCTTCCAGTCTGGACGGGTGTGATTCTTCTGGTGATCACCTGCATTTCATTCCCGCTT
GCAGCAATACCCAAATTCCGTCAGGGCAGGTTTAACCTCTTCTGGTACTCACACATGCTTTTCGGACCCTTCTTGGTTATTCTGGCATTCCATGGAGCCA
CATCATGGCTTGCTCGTTGCTCGGCTTACATTTGGATTACGCCCCCATTCCTCCTCTACCTGATCGAGCGTCGTTTCCGCTATGCTAAGATGTTCGCTGC
ACCCGTGCGTATCATGGAGGCCATGGAGCTGGATGGAACTGTTGCTTTGTTTATCGAAAAGCCCCGTCGATTCGTCTACAGGCCCGGCATGTACTTGTAT
TTAAATTGCCCACAAATTTCATCTCACGAATGGCACCCGTTCACAATTTCGTCAGCTCCCGGCGACAACTACATCAGTGTTCACATTCGCGTATGCGGTG
ACTGGACAGACGCTATTGCTCGAGTTATTGCGGACTGCCACGCATGCAATTTGCAGTATCCTGATGTGTATCTTGATGGTCCGGTTGGCGCTCCGACCCA
GGACTACCATCGCTACAAGACGGTGATTTGTATCGGTGGCGGCATTGGTGTCACCCCGTTTGCGTCAATATTGAAGGACGTGGTCCACCTCTGGGAGGAC
AATCGCTGCCTGAACTGCAATCATGTTCGCCACCCGAGCTCTTTCCAGATCCAAAAGTTGTATTTCCACTGGGTGACCCGAGGCCAGGAGTCTCTAAGCT
GGTTTGAGGGCACCATGAAGCAGATCGCCGGAATGGATCGTGACAACGTCATTGAGACCCACCAATACTTAAGTACGGTGGTGCTGGGTGGCGAGGAGAA
CACTTCGCAGCTGAAGATGTTTCAGGAGTTCGTGCATGAACAGACTGGAAAGGATTTCGTTTCTGGAATGGACACGAGGCAGCTCACGCACTTTGGCCGC
CCAGACTGGGACAAGGTCTTCTCGGCTGCGAGAGCAAAGCACCCTGGCGAGGAGGTCGGTGTGTTCTGTTGTGGACCCCACGAGCTTGAGGAGATCCTAA
ACACCATGTGCAAGAAGTACTCGTCTTCGAAAGCGGATGGCACCTTGTTTGACTTCCACTCAGAGAAATTCGCCTAA