Transcript Name :
Phyli_Pl_113150
Orientation:
(-)
Number of Exons:
6
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
JmjC domain23.104PS51184
HmmSmart predictionP-Valprediction_id
JmjC domain0.000000002SM00558
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-625
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        2480 bases(100 bases per row)
TGAGCGAGGTTGCCGAAAGTCAGCCTGCCAAGCAGGACACACCAACTTTGCAACCTCCCACGGACAGCGAAGGACACCCCGTTCGCGAGTGGATTGATAC
GCTGCTCCAAGCGGCCGTGATCGCTAAGGACAAGCAGAAGAAACCGGCACCGAGAGAGGCGACGTCTGCAACTGCAGCGGCAACTACGACTGCTGAAGAC
GTTACCACAGCTACTGCTAGTGATGCAGATGCTAGTGCATCTACAGAAATGAATGCAACTAACGCAACGGCAACTAATGCAACAGAGGAAACACCGAGTG
AGTCGAACAAGGAGCTGGAAGATGAGCACAAGACAACGGCTACCTCAGATGCAAAGGACACCAAGGACAGCACAGTACCGTCTACTGCAGACGCTATAAA
ATCCGAAGATGGAACGTCTGCTCCGGCTCCCAAGCGATACCGTCGCCGACGCTGCGAAGTGGAAGGTTGCACCAAGTTTGCGCGCTTTAACAACGCTTGC
TCAGGGCATGGTGGCAGACGACTCTGTGCGGAAGCTGGATGCGAGCGCGTGGCGCAGTTCGGCCACAAGTGTAGCGCCCACGGGGGTGTCAAATTCTGCA
ATGTTGAAGGATGTCATCGTGCTGTGCAGTCTCGTGGTTGTTGCAAGACGCACGGCGGAGGTGTACGGTGTCAACACCCAGACTGCACGAAGGGCGCCAT
ATCCAAAGGCTTCTGTCGGTCGCACGGCGGCGGGTCGCGGTGTGCTGAAGAAGGATGTCAAAAATGGGCCCAGCGACACGGGTACTGCGTGCGCCACTCA
AAGTCTACCGATGGTCCTAAAGCGGCACCTAACCAGCCAGTCCCAGTGCCAACAGATCCATCGCTAGAACCACCACAACCGAACATTACGTCGACTTAAC
ACCGTAGCAGAAACAAACCATACCAAGTAGCTTGACTACAACACATACAGTTATACAGATCAAGCTCGTACCTCACGCAGCGAGATTGAGTTTGTGTACA
CCACACCACGTGTTCATTAACTGATCATCATTGTGATGGCTTTTTCTAACGCTAAAGACCCAGTCTGTCTCGAGGGCTTCACAGCTCAGTGTGTGAAGCC
GACTAACTTGCCAAAGTTCACTCCTGATTCTGTCCATCTGCTGGAATCCTATGCGGCGCACCACAATACTCGTAAGAACAAAAGACTAATGACCCGACAT
GTGCAGCAATTTGTGCTCACAAACCTGTATTACAATAGTGGTGGACATTGCATGTAAGGAGCGATCGAGTGGCTGTTACTACGGCAACGAGGCGGCCAGA
CAGAGCGTGGAGTTAAAATTCGGTGACTTTGTGGACTATTACCAAGCAACATTCAGGAAACAGTCGCATTGGCTGCAAACGGTGGACGACCTGGAGTTTT
ATCTGGCGCAGTGCCCCATTGCAGTGCTCAAACCTGATGCAACATGCACCAAGGCCAGTCTGCCGGCAATTATGGACGATTTTGTCTTGTAAGGAGCTTG
ACTTTCTTCTTTTGTGGGCTTGACTAATCTCTGTGAGTGTGTCCGAATTAGGCCGACATGTCTTCAGGATAAACCAGTTACTCAAGTGAATCTATGGATG
ACTGTGCAAGCTGGTCGGACGACGCTGCACTACGACGCTTATCAAAACATTTTGGTGGTTTTGTATGGGAGGAAGACAGTCACGCTGTATCCTCCGTCAG
ACACGGCGAAGATGTACCCGTTCCCATTGCACACCAAGTCGGTGAACCACAGCCAAGTTAACGTCGCACAGCCCGACCTCGAGAAGCATGCACGATTTCG
CGAGGCATCGGCTCAACGTTTCGAAGTCGTAGCTGGAGGTGCAGTACTCTCTACCCAGCAATCGTGACACGTGTTGATTCTGGTCATGATGATTAATTTG
TAAATGACTGTCTGTTGCAGACGCACTTGTAATCCCAGAGGGTTGGTGGCACCAAGTGGACTCAGACGAGTTTACCATTGCTATCAACTACTGGTGGGAT
GGTGTGCGAGAACGACTCGTAGAAGACAAGCGTATGATTCCCTACTACGCTCGTGTAATGCTGGAGGAACTGGTTAAGCAGCAATGCGAATCACGCCTTC
TAGCCTCGCGGTCTTTGTCAGGAGTAGGCAATTTCAAAGATGAATGCAGTGCAGCGACAGCTATCTGTGCCGCAAACAACCAAGATGGCCGTGAGAGGGT
GTTGTTATCGCTAGATCGCAATATCTTCCTGAAGACACAGCGGTTCCTGGCAGTTAACGCCCCTTTAGAATGGCGGAAGCTGTTAGCAAACGCAAGCGTG
AGCTTGGTAGGGGTCTTGACCAAGGGCTGGGAGAGCGATGATCTGGCGTCGGATTTCCTAAGTGTTTTATTTGGCGCTTTTGGGGATGAGGAAGATGCTA
TAAAAGATCAACTTGCGGCTAAGCAGGCGCAGTTCCGACAAGACTGTGCTACCGAAATGTTTCAGGCGATGTTTGGCTAG