Transcript Name :
Phyli_Pl_113116
Orientation:
(-)
Number of Exons:
1
Description :
endomembrane protein 70-like protein, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-278
279-301
302-343
344-366
367-375
376-395
396-414
415-437
438-451
452-474
475-494
495-517
518-531
532-554
555-566
567-589
590-608
609-631
632-642
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1928 bases(100 bases per row)
TGTGGATGAAGAGCGTGGCGCTGGCCGCGCTTCTGGCGGTGCATAAGGCCAGCGCAGCCTTCTACGTGCCTGGCGTGGCGCCCGAGTCCTGGGCTGCGGG
CGAGACCGTGCGCCTCAACGTGAACAAGATCACGTCCACCAAGACGCTGGTGCCGTACGAGTACTACTACCTGCCGTATTGCAAACCCACGGCCACCAAC
GAGCAACAGGAGAATCTGGGTGAGATCATGGCAGGAGACGCCATCATGGACTCGCTCTATAACATGCAGATGGAGAAGGACGCGATCTGTCAGGTGCTGT
GTAAGCCCACGACGTACACGTCCGAGCAGTCCCAAGCATTTATTGACATGATCAAGGACGAGTACTACGTGCAGTGGGTAGTGGACAACCTCCCTGTGCT
GTACCGTGACCCGACGGACTCCCAACAGGCTGGATCGTTCAAACGAGGCTTCCCTGTGGGTGAAGTGGATGAGGATGGCAAGTATTTGCTGTACAACCAC
GTCCGCATCATTGTTTCGGTTAATGCGGACCCATACGCTGAGGAAGACGGCGACGTCCCCAAGTGGCGCGTTGTCGGCTTTGAAGTTGTGCCAACCTCTA
TTAAGCACAAGTATGAGAACGAACCTATGGCTGGACAGGAACTCGACTCGGACACTTGTGGCAAGTTTGTCAACATTGAGGAAGTGTCACAGGGCAACTA
CCAGTACTTGAACCCGGAAGGCGAAACCACTGTACTTTACACGTACGACGTGCAGTTTGTCAAGTCAGACATTGTCTGGGAGGAACGTTGGGATCGCATT
ATCAGCAGCAAGAGCTCCAACGATCAGATCCATTGGTTCTCCATTATCAACTCGCTTATGATTGTGCTGTTCCTCACGGGTATGATTGCTATGATCATGC
TGCGCACGCTTCACCGTGATATCGCTCGTTACAATGAAGTGCAGACCACGGAGGAGGCGCAGGAGGAGTCGGGGTGGAAACTTGTCCACGGTGATGTGTT
CCGTCCCCCGCAGCTTTCGCCCATGCTTTTCTCGGTTGTTGTGGGCACGGGTGTACAGGTGTGCTCCATGAGCGCTTCGACGATGATTATTGCACTGCTA
GGTCTGTTGTCCCCAGCCAACCGCGGTTCGCTGCTTACGACGTTGCTACTGCTCTTCGTTTTCATGGGCAGCTTTGCTGGATACCACTCCTCGCGCACGT
ACAAGATGTTCAACGGCAAGGATTGGAAAAAGAACACAATTCTCACGGCGGTGCTATACCCAGGTCTGCTGTTCGCTGTATTCTTCTTGCTGAATCTGGT
GCTTTGGGGCAAGTCTTCATCACAGGCTGTCCCGTTCGGTACGCTTTTCGCTCTGCTCGTCCTATGGTTCGGTATTTCGGTGCCTCTTGTTTTCCTCGGA
AGTTACTTTGGTTTCAAGGCTGCTGCTATTGAGCAGCCTGTGCGCACGAACCAGATCGCTCGTCAGATTCCCGAACAAGTGTGGTACCTGTCTTCACCGT
TCAGCATCCTTGTGGGCGGCATCTTGCCCTTCGGCGCCGTGTTCATTGAGCTGTTCTTCATCATGTCGGCGCTGTGGTTGCATCAGATTTACTACGTATT
CGGCTTCCTGTTCATTGTGCTGCTGATCCTTGTGGCTACGTGCGCCGAGGTTACGGTCGTGATGTGCTACTTCCAGCTTTGCGCAGAGGACTACCGCTGG
TGGTGGCGTTCGTTCCTCACCTCTGGTTCTGCGGCCGTGTATTTGTTCCTGTACTCATTCCTGTACTTCTTTACGAAGCTGAACATCACCGCGTTCGTCT
CGGGCATTCTGTACTTCGGCTACATGTTCCTGATCTCGGTCACGTTCTTCTTCCTCACGGGAACCATTGGCTACTTCGCTTGCCTCTGGTTTACGCGCAA
GATCTACAGCTCCATTAAGATTGACTAA