Transcript Name :
Phyli_Pl_113123
Orientation:
(-)
Number of Exons:
3
Description :
hypothetical protein PHYSODRAFT_248463
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-184
*** None ***
PositionContextScore
175ARRRYKR|AL0.709
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        684 bases(100 bases per row)
TGGCCGCCACCAAGCCGTCCAAGAAACAACGTGGCAAGCTGAAAGCCGCCAAGACGAAGAAGGAGACGGCCAAGTCGCATGTTAAATTTGACGATAATGG
AGACAAAGTGGTGCCGAAGAAGCGCGCGCGTGCAGCCAAGAAGAAAAATGCCGATGAGGTGAAAGAAGGTGGAGGCAAGGCTGACCGCTCTCCGGAGATG
ATCCAGCAGGCCAAATACTATCTGGAGCAGTGGCAGAAGCGCGACGAGCCCAAGGCTGATGATGAATTGCCCTGGAAGTTCAAGGTATGTCGTAGAGCTC
GACTTGTGGAAAGGAGGTGAAATCGCTCATGGTTTGATGTTGCAATGCAGACAATTAAGCAGCAGTGGATTTTGCGCTGGATGTACGAAGCCGATGTCGT
ACCCAAGTCCATGTTTGCCATTGTGTTGGAGTATCTCAATGGCATTCAAGGTGCTGCACGCAAGGTTAGTGTGTCGGAAGTTTTGCAATGTTCATGACTG
ACAAGGGGTTGTTATTTTCGTGATGTAGCGCGTGATGGAGTCAGCGCAAGAAATCATTGACATTGGGGTTCCGGCAAAAGAGGAAGAAGAAGCTGCGGCT
GAGGAGAAGGAAAAGATGCTCAGTATTAAGCTTGCTCGGCGACGTTACAAGCGTGCGTTGCAAGTGGCGGAACTACTTGCTTAA