Transcript Name :
Phyli_Pl_113133
Orientation:
(+)
Number of Exons:
6
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Ankyrin repeat-containing domain16.945PS50297
Ankyrin repeat8.63PS50088
PDZ domain9.29PS50106
HmmSmart predictionP-Valprediction_id
Ankyrin repeat2300SM00248
Ankyrin repeat320SM00248
Ankyrin repeat0.0091SM00248
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Ankyrin repeat-containing domainIPR020683
*** None ***
InsideOutsideTMhelix
1-647
*** None ***
PositionContextScore
626GNAKEKR|SL0.579
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        2283 bases(100 bases per row)
ATGATAGACGCTGAGTCTGATGCCAGTCTGAACATTGTCGAGAGCTGCCGAAGCGTGGGCGACGAGTCGTCAACTACCACGGCCGCCTCGACCAACGAGC
AGGAAGAAACAACAGCAAGCGGAGACGAACAGGATTGTGTCTCAGTCGAGAGCAACGAGCGCGTAGAAGCCGAGATCGAGCCGGAAGGAGCAAGTGAAAA
GGAGAGTGAGGAGACCGGTAGCTTAAAGGAAAAGGCGGAGAAGGAGGAGGCTGTGGAAGCACAGCTGAAGGAGGACAAGCCCACAGTTATTAAGACACAG
GACGAACCAGAACTGGAAACACCCAGTGACGACTCGTGGAAGGAAGAGCAAAAGCAGAAGCGAGCGTCATCAGCACGTCCTGCAACTGCGAGAAGTGCCG
AGTCGAGTGCTATCACTCGCCGTCCGTTTGTCCCACTGGCATCCAAAAGTTGGCGTGTGCGAGCCATGCAGTCCAACACACAGATCACGCGTCTTATGAA
GGCGGCGTTGCTTCAGACACTGCTACATGCTATTCGTACTGGATCAGTGGAGGGAGTGAAAGTCGCGATTGAACGAGGAGTGCAGGTGCAGTACTTGGAT
AGCCGCCAGCGCAACCTTGTCATGCTAGCATCCAAGTGCGACACCGACGCTCGTCTACACATCGCAATTATTCTACTTGATGCTGGTTGTGATATGAACC
ACAAGGACCAGCTAGGCTGGAGCTGCCTACATTACGCTTGGTATGTGCTAAACGCGAAGTATTACGTGGATCAGTATGCAGTAGACTAACTTTTATGTTG
TGTGATTTTAGCGCCAGTGGAGCTGATGAGGTGGCTGCAGAACTAATTCGCCGCGGAGCTCGTGTTGAGTTTAACCCATATGGATACGGCCCTGAAGACT
TCAATATTCCTAAAGTGGCGCGTGCGAAAAGTTTGCTGCAACATACAGAGCAGCTACAGCACGAACAAAATGTGTGTGCGGCCTGGACATACTTTCGCCG
TCAGGCTGAGAAAGCTGGCTATAGCATCAAGTGCAAATCGGTATGCTTTGCGGAGAGTTATTAAAGTACTGTACTCGAAGACTAACTGAGTGTGTTGTGC
TTTTGTTTGTAGAATTGCGATCTTGGCAAACCTCTGAAGATCACGTTCCAAGCCCCTGCTGGACACAGCCCTCTGGACCGCATACGTGTTGTCGACATGA
ACTCGGACGTTGCATTGTGGCTTCAAGTGTCTAAAACGTTTAGTATCCCTCCTGGGGATGTAGGCACGATTACATTGGATGTGGAGACGTTGGACCGACC
GTCACTGTATCGCATCGTTTACGAAAAATACGAGCCGACGCCCATCCAACTACCGGCCTCGGTTGCTGAAAGCAACTTATGTGTCAAGAATTTAGACACT
GGAACTACAGTATCGATGGGTAGTGTCAACAACTTGGTTCTGAAGGAGCTCAAAAGCTCCCGATCGTCAAAGAAATCGACGAAATTGCCGAGTTCGGCCA
GGTGAGTAGTGATGGAGGCACGTCCCATGCTGCAGTTTGTACTAACAAGCGTTGTGATGTTTTTTTGTAGGCCAGCACCCAAGTCAGACAAAGCTACAGA
TGTGATGCGAAGAGGATCGACGACGTACGTCTTATGTATGTATTATGCATGGGATGTATGTCCTAATTTACGAAATGTGGTAACAGCCGAGCTCGGGAAA
TCGCCGAAACCGTACAGGAAGCAATGGTAGAAGAGGATGAAGAAGGAGAGGAGACTGAATTTTCAGCTGATGAAACTATTACGACACAGGAGGTTGCTGA
ACATCCGGCGGTCACTAGTATTACTGGTGTGTATAAGATCGTGGCAATGGGCGTCGTCAGCGTTTCGACGCTAAGAACTGCCAAGGCAAACGAATATGAA
ATCACTATTAACCGCAAGGGACCACTTGGGCTTCAGTTGGTACGCAGCATCGCTTTCAGGAACCACTGACACATCTAACGTCCTCGTCCTGATTTTGTTT
TTTAGGCACCAAAGATTGATAGCTCGAAGAGATCTCCTCGTCTTATTGTGCGCCGAAGCCAGGGCCAAGCGGCAGCTGTAAACCCGGGTGATTGTCTTGT
CGCGATCAGCAACGCTAATATCGAGCACGCTGGTCTTAAACACACGCTATGGGCGCTGAACGATGCAAAACGCCCGCTTGTGCTGCGCTTCCGACGTGGT
AATGCCAAGGAGAAAAGGAGTCTGTTCAAGGTTGGGCTGTCGAAGATCACCGGACCTCGTAGACAGCCTGTCATTGCTGTGTA