Transcript Name :
Phyli_Pl_113141
Orientation:
(-)
Number of Exons:
1
Description :
serine protease family S10, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Peptidase S10, serine carboxypeptidase1.3e-22PR00724
Peptidase S10, serine carboxypeptidase1.3e-22PR00724
Peptidase S10, serine carboxypeptidase1.3e-22PR00724
Peptidase S10, serine carboxypeptidase1.3e-22PR00724
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-40
41-60
61-570
NN-scoreoddsWeighted Score
0.6776.7450.013
*** None ***
TypeScore
mitochondrial52.2
GO
Biological ProcessGO IDPrediction Method
serine-type carboxypeptidase activityGO:0004185IEA
proteolysisGO:0006508IEA
*** None ***
*** None ***
Sequence
        1712 bases(100 bases per row)
TGTACCAGCGCTCCGATCCGCTGAACGAGACGATGCCGCTCACGCGCGGGCTGCGCTCCCGCCAGACGCTGCCGGCTGCAGGTCGCTCGCGCCGACTGCT
CTCGTCCACAGCTCGGCGCTTCATCCGTTATGGCGTCGCGTGCCTCTTGTTTCTAGCTGTGGGAGACCTCATGGTGACGCTGCAGCGCTCGCTACAGACG
GAGAACCTCATTCGCACAGGCGAACACAGAGCCCAGCCTACGGTGATGGAGGACTCAGCCGATGCGGAGTCTCCAGAGCTGCCCATTGAATCCTTTCCTG
GTTCTACTGATGAGATTCTGACACTTGCGGGTAAACCCAGTGACTACACATCACGACTCTTCTCGGGTTATTTGCCATTGAACAATGGAGGCCACGCCTT
CTACTTCCTCGCTGAGTCTCAGAGCCCCGCGCCTCAAACGGACCCCGTGCTACTTTGGCTAAATGGAGGACCGGGTGCCAGCTCTTTATCGGGCTGCTTC
TCAGAGAATGGACCACTATTGGTGAACGGGGATGGGAAAACACTGAGAGTGAACAAATTTGCTTGGAACCAACAAGCCAATCTACTGTGCATCGAGTCGC
CCGTGGGTGTCGGTTTTAGCTACAACTCCAGTGGAGTGTACGAGGCAGACGATCTCTCTCAGGCTCAAGATCTGTACGACGCACTGCAGAAGTTCTTTGG
GAAATTCCCGTGGCTAAGAGAGAACAACTTTGTCGTCTCTGGAGAAAGCTACGGCGGGATTTATGTGCCGACGACGGCACTTGCTATTCTCAATGGAAAC
GCGGCGACTTCAGATCAGTCACAGCACATTAACTTGAAGAAATTCGTGGTGGGTAATGGCGTCAACGAGTACATGGGACTTTCCACTGCCATGTTTGCGT
ATTACCATGGTCTTTTGAGCACGGAAATGTACCAGAAGTTCCGAGGTAGCTGTTCCGAGTTCCGCGAGTTCGAAAAGAGCCCTCTCGGTGCGCCCGGTAT
CAGCAATGCTAGCCCAGAGTGCACCTCAGCCACGATGGATATGTTCTCGACGTTGGTATATGATCGCATCAACATGTACGACGTCTATGGCTCGTGCGCT
GGATCACCCAAAGAGGATATCCAGCGTCTTGTGAAGGAGATCTTGACACCGTCGACGCCCGGGAAGATGCCACACCCTATTGGCAACACGATGGACTTGT
GCCTGGATAATAAGCACCTCGAATCATACTTTAACCTGGTCGAAGTCCGTGACTCAATGCATGCGAACCCGACACTAGCTCATTGGAGCGCTGACGCACT
CACTACGGCGACCATGGATACGCTTAGCGCGATTCTAGGTGTCGATCACCCGATGTTGCAGCACCCCCAAATGTTGAAGTACACTCCTACACTGAATGCT
GAAGTGACGCCCTTGTGGCGCCAATTACTTGAGGGTGGGGTGAAGGGCGTTATTTACCACGGTGATGCTGACATGGTCTGTAATGCTTTGGGTGGGCTTT
GGGCGGTAGAGTCGCTAGGTCTACCCCGCTTGACATCACGGTCGGCATGGACTTACACAAAAGGTAATACGAAGCAAACGGGCGGATTTGTGGAGACGTT
CAAGGGGATCACGTACGTGACCGTAAAGGGTGCAGGCCACCTCGTGCCTATGGATGAGCCCGAAGAAGCCAAGCAAATGCTTGATTTGTTTGTGTTCAAT
GACTTGGAATAG