Transcript Name :
Phyli_Pl_113130
Orientation:
(+)
Number of Exons:
4
Description :
autophagy-related protein, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-116
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        559 bases(100 bases per row)
ATGAGCTCATTCAAGAAGGAGCACCCGTTCGGTACGTGGGTTTTCCTTCCACGTAGTCACTTCGAGTCTCGGATATAGATGGTAGGAAGCCTAAACGACG
TTTGATGGTGCTGTATTTACAGAGAAGCGCCAGGCCGAGGCACAGCGCATCCGATCCAAATACCCCGACCGAATTCCAGTATGTGGTCTCAGTGATCCTT
GAATTTTGTGCGTCACAAACTGACAGTCATGCAGGTGATTTGTGAGAAGGCAGACCGCAGCGACATCCCGGACATTGACAAAAAGAAGTACTTGGTCCCA
GCCGATCTGACAGTTGGTCAGTTTGTGTATGTGATCCGAAAGCGCATCAAACTGAGCCCAGAGAAGGCAATCTTCATCTTCATCAACAACGTCCTCCCTC
CCACCGGTACGGACTTTAATGTTGCTTTTGCACATGTACAGCTTACTTATTTTTGCTGCTTCGTTCAGCTGCTTTGATGTCGAACATTTACGAAGAACAG
AAAGATGTGGATGGCTTCCTCTACATCACCTACAGCGGCGAGAACACCTTCGGTCAATA