Transcript Name :
Phyli_Pl_113128
Orientation:
(+)
Number of Exons:
4
Description :
hypothetical protein PHYSODRAFT_293820
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
BRCT domain18.709PS50172
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
BRCT domainIPR001357
*** None ***
InsideOutsideTMhelix
1-87
NN-scoreoddsWeighted Score
0.9363.9760.008
PositionContextScore
64SVKRKKR|QP0.586
TypeScore
nuclear69.6
GO
*** None ***
*** None ***
*** None ***
Sequence
        476 bases(100 bases per row)
AGATACTATTTGGCGAAGCTGGTGCAGGAGCATGGTGGCAACGTGGCGTACGAAGTTTTGACAAGGATATTACAAGTGCAACACGTTCTTTAATTGATGC
TTGTATTACGACTCATTTTTTGCAGATCTATGATGACTACTACACGCGTCACTCACATGGTCGGCTCCAACTTGAATGGGTCCAAGGCGGATAAAGTACT
GAAGGTAAGGACGAATCAAGAATTCTACTGCGTGTGCTGCGATCTAATGAATGCCTTTACCCGGACAGAGCTCAAGCAAGATCAAGTTTGTGAGTCCAGG
TGCATTCTTACGTTGTTGACGATACTGTATCTTGTCATAAGCACTTATGCTTTGGTTTGGCCTGGCACAGAATGGATCTTGCAGTCTGTCAAGCGCAAAA
AGCGCCAGCCCGAGTTCGAATTTCTCGTCTACAAGGATTCAATCGCTACAGGTTCGCTTCGTGCTGCATTTTCCTA