Transcript Name :
Phyli_Pl_113115
Orientation:
(+)
Number of Exons:
7
Description :
hypothetical protein PHYSODRAFT_343759
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-609
*** None ***
PositionContextScore
102AAGRPKR|AT0.686
380ALARFDR|SA0.605
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2354 bases(100 bases per row)
ATGACCGTGTGGAATGTGCGTCTGCGAGGACCCCGAGGCAAGCAGGTGGTGCTGAAGATCGACCCGGACGCCAACTTCAAGACATTCTCGGGTACGTGGG
TGTTGGTCTCGTCATTGTACTGTTGTATCTGATGGTTCCTCTCTGCAGAGCTCGCAGCTAAGGAATTGGGTCTGAGTGCTAAAGACTCGCCCACATGTAC
GTGTTCCGCACTATTGTCTTCATTTACAACGGTGAAACCTAAATTGTCGTGGCGTGCTGCAGTTCGCAAAGGATTTCCGCCTCGAGCAGTCGAAGTGGAT
GGCTTAGAACTCGTCAAGGACGTCTTCGAGGCCAATGATACCGTAGTAGTGGACATGCACTCACGCTCTTCAACTCCGGCGCAAACTGTTGCTTCTGCTG
CTAAGAAGGCTGCAGGGAGACCGAAGCGAGCAACCGCGAAGAAGGCAGCAGTGAAATCACCGAGTGGTGGCGTGCATACATTGAATCCTTCGAGTAGTGC
GAAGAAGAAGGCACCGTCAAAACGGAAAATCACAGGCAACGGTCATCAGCTTGGGAGCTCGCTGGAGACTAACCAATCGACTGTAGAGGCTGCAGGCGAT
GAAGATGAACCACAACGCAAATATCGCCGTATGAAGGCGATTAATCTAACGTCAAAAGAAGATGTGGGGATCGCTCTGGTGAACGCTGTGAGCGGTCGAT
CTAGCGATCGTACAGCAAAGTTCTTCCGCGCAGCGACGAAAAATGCAGTAGAGCATCAATATGAAACAACGCTGGCAACTGCGAGGTTGAATGCCGCACT
AGCACATAAATTTGAGATTGAAGAGCTATCTACTACCCGACGCGCTGATGGCAGTGCTGCTAGACTGCACGTACGCTTCAAGGAGACACCTCGCAAGTGG
AAAGAGGAGACAGTGGACCTACTAAAGACGGACGAGTTGCAAGCCATTTTGAAATACGTATTGATTTCTGGTGGTGAGACTGGACACGAAATGCTCAAGC
CTTTTAACATGGCTCAGGTGTCTACAAGAGTCTTCTGGAATATCGCGCGTTTATACGATGGAGACGTGGCTGCTGGTCTAGCGGACCTAGTACCTGATGA
AGACTGGTCGTTCTTAGACACTCGCACACGGTAAGTCTAGTAGTTGTTCCATTGTTTTATGCGGTGTGAGGTTTGTATTTGACACTGGTGCTGGGTCATT
TCAGCGTTATGTCAGAGAAGGCTATGGAGGCGAAGGTAAGAGTCATTATTGTGCTTCGTGGGTCAGTTCGATAACTTAATCCTTGATTATTCTGTTGGTT
CCTTACTAGGCAAATGAAGAGCAGTACAAGCTGTGGAAACAAGGTAAACAGGAAAATGGTAGGGATGGTCATATGTCTTCTTCGAGGGCATTAAAAAAGG
AAGACGAGCCAGCGAACAGGGCAGCAGACAAAGAGACAAAATCTGGAGTCATCGAAGTGAACTTAAGGGATGAGGAAGAGATTACGGAGACAAAATGTGA
GCCACTAACTCGGACGCCTGCTATTTCAGCAACGGAGACGTCTCCTAGCACCCTACGAAATGCGGCAGCACAAGCAGCGCTGGCCCGATTCGACCGAAGT
GCGCAGACAAGTGCGGTCGTATCCGCTTTTCTTCAAAAAGAAAAAGCACCTACATCATCGTCTATTAAGAAAGAAAGTGTGGACGCCGATGATAAAACTG
AGTCTGAGGAAGAAGTGGAGGAAGTTATTACGGTCTACTGCGATTCTTGCAAGAAAGCGCGTATTCTATCACCTGAAGAGGGCGATAACGCTAAGCTTGA
TCAGGATCCATGGACATGTGCCAACTTATCGAGTGCTGGACGCAATGGTGGGTGCGACGCAATCGACGACGAGGTAGCTCAGATTACGGGTGCTCCTATT
GCTGAATGGCTACAAAAGACTGCTATCACCACTCGGAGAGAACTAGCAGACGCTGCGGTGGGAGCTACCATGCACGCTCTTGTGGATCCAATGGATCCAT
CGACTAAGACGTTGCAAGATAAGCTTGAGCAGCTTATTGACGAGGTGAGTGAACCTTCATGGAACTGTGTTTATCGATAACTCTTGACTCATTGTACGTG
TGAATGAACTAGGCGCGTCTGGATGAAGTGAACGACTGGATGTCAGAAATTGTTGGCGATGCTACCGTGGTGCAACGACTGGAGGTTCAGAAGCTGGGCA
CACCTGCAGATTTAATCGCCACACCAAACGACTTGATCCTCGAAGCTATTGGCAGCACTGCCGATATCTCTATTAAAGTTATTGACTCGTGGCATACTCG
AGCCCAGCGTTTGGTTAACAAGCATCCCTGGTTGGCAGACTGGCGGACGCTGTA