Transcript Name :
Phyli_Pl_113126
Orientation:
(+)
Number of Exons:
2
Description :
hypothetical protein PHYSODRAFT_551952
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
AAA+ ATPase domain0.00000000011SM00382
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-338
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleotide bindingGO:0000166IEA
*** None ***
*** None ***
Sequence
        1099 bases(100 bases per row)
ATGTTCAGCACCACCTCGAGTAAGACCAACGTGCCGGCGCCCGTGCTGCCGTGGGTAGAGAAGTAGTAAGTGCATCATGTCTCTATGCCTGTTTACTTTA
CTGTGCACAAATTTCACACTCTAATGCCTTGTCGTTGCTGTGCTCTAGTCGTCCAAAGAACGTGGACGAGATCTCCCATCAAGAGCATGTTGTGGCTACA
CTCAAGACGTCCATCGCCAATGGTCAATTGCCGCACTTGCTGTTCTACGGACCTCCAGGAACTGGTAAGACGTCCACTATTGTTGCAGTAGGACGCCAGC
TCTTTGGACCAGACTTCCGCAAGAACGGCCGCTTCCTGGAGCTGAACGCGTCCGATGACCGAGGCATCAAAGTGGTGCGTGAGAAGGTCAAAAGCTTCGC
CCAGGGTGCCATCAGCAGCGCCAGCGGCCTGCCACCATTCAAGATTATTGTGCTGGATGAGGCCGACTCCATGACGGGAGACGCGCAGTCGGCACTTCGC
CGCATGATGGAGAACTACTCCAAAGTCACGCGTTTCTGCCTCATCTGTAACTACGTGAGTCGCATCATTGAGCCGGTAGCCTCACGATGCGCCAAATTTC
GCTTTGCGCCGCTGGAGAAGGTCTCGATGGCGTCACGTGTGCGCTACATTGCCTCAGAAGAGCATGTGAATGTACCGGATTCAGTACTGGAGTCCCTGCT
CGAGTGCTCTAATGGAGACTTGCGTAAAGCGATCAACTATCTGCAAAGTGCCAAGCAACTTTGTGGTGATGACGAGTTGTCCCAAGATGATGTCATTGCT
GTGGCTGGTCTTGCTCCACCAGAGTTATTGCAACAGTTTTGGGTATCAGTAGCTTCGAACAGCTTCGAGAAGATGAAGACGGACATCGAGAGTATCTTGT
TGGCTGGATACCCGGTGCTAACGATTTTGCGGCAACTGAATGACGATGTGCTAGCACTAGAAAAGCTCAATGACGTTCAAAAGGCCAAGATTTGCCTGCG
CATTGCTGAGGCTGACAAGAGGCTCGTCGACGGTGCTAGTGAGCACTTTCAGTTGCTAGATGTGGCATCCTATGCCATGCGCGTTTACCATACGTCGTA