Transcript Name :
Phyli_Pl_113131
Orientation:
(-)
Number of Exons:
3
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
WD40 repeat12.012PS50082
WD40-repeat-containing domain11.866PS50294
HmmSmart predictionP-Valprediction_id
WD40 repeat0.000023SM00320
WD40 repeat0.0029SM00320
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-272
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        1029 bases(100 bases per row)
TGGCGCACCCGATCAAGAAGCAGGAGTTCTTGGGCGCTGTGACGCTCGTGTCTTTCTCATCGAATGGATCTCTACTCTACGTGGGCGTAGGTCCAAGCGT
TTTCCTCTACGCCACTGCAACTGGCGAGCTTCTGGGCGAGCATGACGTATTGACGCGAGGCATTCTGCACGGCTGCGACATCATTGGACTTCCTGGCTCT
GATGCCTCCATTAAATCGTTTTCTGGTGCTTTCTTCGGTCAAAAGCGTGCGTCATGTTTCCAAACCTTACCACAAACTCCAGAGGCTGCTCGTGGACTTG
AGGGTTTTCCAGTGCTGGGAACACCGAAAGTGTTTTGTGACTGGGTGTTCGACGTGCAACTACTAACAAATGACTTAGAGCTGGAGGAGAACATGAAGCT
GCTGGTTGCAGTTGGACTTGCGCACAATTTGGTGCAGATATGGGACCCGGTGGATAACACTATTTTGCAAAGCGTGCAATGTGCTGAACGCTGCATTTTG
TACGCGTTGGCATTCCATGGACGATCACTGGATGAGCTTGTGGTCGCTTCAGGAACAGTGTTTCAGCAGATTTTGTTGTGGAATCCGATGGAACATGGAG
GTAAAGAGGCTGTTGAGCCGGCTCAACGGCTACATGCTCACGATGGAGTGCTGTTCAAGCTAGCGTGGTCCTCGGATGCGCGCTCGTTGGCCTCCGTCTC
GGACGATCGCACAGTGCAATTGTGGTCGAATAATGGAAAAACAATGATGGAACAACTGCACTTACCAAGAGCGGCGACCCGTGCAGAACTGCTGGAGAGG
GAGTACTCGCCAGTGTTCCGAGCCTGGGGTCACTCGGCGCGCATTTGGGATGTTTCGTTCTGGGAGAGAGGTGTGGTAACAGCGAGTGAAGATGGTCTTT
GCAAGCTTTGGGATCTAGATGGCAGTTGTGTAGCAACACTGCATGGACACATGGGCAGACATGTTTGGCGTGTAGCTGTTCATCCGACACAAATGATTAT
TGCAACAGGAGGTGGTGATGGTGCTGTAA