Transcript Name :
Phyli_Pl_113124
Orientation:
(+)
Number of Exons:
3
Description :
hypothetical protein PHYSODRAFT_470700
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Cyclin-like0.00000088SM00385
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Cyclin-likeIPR013763
*** None ***
InsideOutsideTMhelix
1-299
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1018 bases(100 bases per row)
ATGTGCATCAATCGCAAACGTCTTCGCACTGAACTCTGCAGTCCACCGACCCAGCAGCTACATATCGCTGATGAAGAGCTGAAACGTGTCAAGACGGAAT
CTCCCACGTCAGTGGAGCGAATGGGGAGCGCAGACAATCAGCAACTAGAGGAACTCGCGACTGCAGCGCACAGGGATGAGATGGTGGCGGCCATTTTGAC
CATCACGTCGGCACTTGGACTCTCGAGGGAGACGTTGCATTTGTGCGTAGGATTGCTAGACAGATATCTGGAGATGCAGAATATTGAGACGATCAGACTT
GAAGCACTGAGCATATCGTAAGAAAAGAACGAGGTTCAAGCGACAGAAGCGAGTTCTAACATTGTCATGGTGCAATTGCAGGTGTCTGTGGATCGCTGTC
AAATTTGTTGAGACCCCAACGACAATTTTTGACAAAAGTATCAAAGAGATTTTACAACGACGAAGACACTCGAGCAATGTAAGTGTTAGGCAATTTTCAT
TTGTGATGAATGGTACTAATAATCTGTTTGTAGTGGACTTGGAATGAGATTCTGGAGTTCGAGCTCAATATTCTACAGCGTCTTGACTTCCGGATCATGG
CGCCTACGATACTAGAAATACTCCAGAAGAGGATGTATAGTATTGAAGGGGACAATCAAGGACACGGGATAGATGATCTACAGTTCGAACAGCGTCAACT
TGCGCTGTATTTTGCCGACCTGTTGCTGCTCAAGGCGCGAGCGAACCAATTCTCGAAGGAACTACTTGTGGATGCAATTTGGTTTGTAGTCTCGGGCAAC
CAAATTGGAGAGGTGAAGCCGCCGCTGCTGGAACCCGTCGTGTTGCTCTATCTCGCTCATCGCGACAACATCAATCCGAATCACCCTGTTTTTAAACCGT
GGTTCGCGCTGCGCTGCCGATATGGTGTCTTCTTGCAGTCACCTTGGAAGGTCCCGTACGATCCGTCTTGCGTCTGCCGCGTCTGCGAGCACGCACAGGA
CGAATTGGCGTCGAAATG