Transcript Name :
Phyli_Pl_113148
Orientation:
(-)
Number of Exons:
5
Description :
glycoside hydrolase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Epidermal growth factor-like domain8.952PS50026
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-4
5-27
28-506
507-529
530-557
NN-scoreoddsWeighted Score
0.6622.0310.004
*** None ***
TypeScore
endoplasmic reticulum55.6
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        1993 bases(100 bases per row)
TGACTGGACGAAGCTTGCTGCTGCTGGCCGTACTGGCAGCCGTCGCCTTGCTGCAGCACATGACTGCGGCTGCGGCCGTCGACGGCGTGATCATTGTGCG
CGGAAACAAGCTCTACAACGCCAACTCTGGCGAGCGTTTCTTCATCAAAGGGGTGCGTTCGAACGGTGCAAAAAGATAGGAAGGAGCCAGCGCCGCTAAC
AGTAAAGTGCACTGGAGTATTATATACAGAAGGGCTAATACTTGTGAATTGTATGAGCAGTTGACGTACGAGTATGCCGTAAGTGATGATTACTACGACA
AGTATTCCAAGGCTGTGATCGAGGAGAACTTGGCGGGTCTCAAGTATAACACACTGCGTCTGTACAACATCAACCCCACGTCGTCGTACAAAAAATTCAT
GACTGACATGGCAGCACTCGGTGTGTACGTGATGGTGTCTGCTTCACCTGATAACGATGCCTACTACGGCAAATATCGTTACTCGACTATTACCAAGAAA
TTGAGCTGTTCGGGCAAAGTATCATCCGGTGACGGTGCTAAAACCGTGGATCAGACGGAGACGTGCTACCCTGCACTACTGCTTGAATATGGCAAGAAGA
TTATTCAGAACTTTGCGCAGTACGACAACACTTTAGGTGTCGTCGTGGCCAATGAAATCATGCAGGCCGATCTTACGGCTGCTTCGTGTGTCAAGGCTTA
CGTATCTGACTTGAAGAACTGGATGACTGTCAATGGCAAGAAAATTCGTATTCTGCCGCTCGCTTATGCTGCTGCTGACAGTAGTAACGACGTAGTGACC
AATGCCGACGACTACCACGTGATTAAGGTCCAGGGACTCCTCTGTGGAGACAAGATGTCGAACGGCATGATGACGGAGAGTATCGATATTTACCTGATCA
ATGAGTACCGTTGGTGTCCCGATTCGACATTCGCAGAGGCATACCAGCGTTACATCAACATGGCACAGGGCATTCCCATCGTGGTTGCTTTTGGCGAGTA
TGGCTGTAAGACTTCTTCTGCAACACCTCGTGACTGGGGAATGGTTCCGTACATGTACCAAGAACCTTCGAAGACAGAGGAGTTTACGGCAGTTTGGTCT
GGTGGTCTAGCTTACTCATATGGTGAAGCTAAACTTGCAGCAGATTCGCTGTTTCCAATGTTCACAGGTACAACAATTTGGCGCGTGTTATCAATCACTG
GAGGATGATTCTAACTTTTCAATTTGTAGGTGGTAGCACCGACTTTTTGTCGACGCCCAGTTCGAAGTCCACGACAGATTACACAAACCTGAAGGCTATG
TTTGCAAAATATTCGGGATACACGGATGATGCCGAATGGACTGACAGTACTAAGTGCACGTGGAAACCAACGGTAGAAACGAAGACGCAGTCCACCAACA
AAGCGGCTACAAAGTACGGCTGGATCGTAAGCAGTTGCTCAGCGAGCAATCTGAAGATTTCTAGCTCAGACTCGTGGACTTGTTCCAGCCGTGAAGGCGT
GGTCTGCACGGACGATGGTGACACGTGTGATGTGACTCTCAGCAGTGCTGTTGGTACGACCCAGGAGAAAATTTGTGGAACGTACGAGGTCACGAGCGGT
GGTGGTACCTGCGAAAGTACATCCGACTGCGGCGGTAATGGTCAGTGCAAGGAATCAAATGGCACGAAATCATGCAGCTGTTTGTCCTGCTACACGGGCA
CGGATTGCAGCGTTAAGGATATTAGCTCGTGTGCTACACTAAGCAGTTCGGACTCGGCTCCTCAGGCCATTTTCGTTGGAGTCGGTGTGTTCTTGGCCGT
TATGGCGGTGGTCTTCATCGCCCTCGGCGTTGCCGCAGCCAAGAAGAAAGCTGGTACGTTTTCGCGGTTCTGGATATGGTTGTACGCTGTATAACTAACA
TTGTGCTACTCGTGTTTTTTCACAGAAACGGACAGGTTGGCACAGCAGGTGAAGGCTGGAGGCAACACCCACTCAAATGATGCCGCCTTGTAG