Transcript Name :
Phyli_Pl_113127
Orientation:
(-)
Number of Exons:
1
Description :
vesicle coat complex COPII subunit SEC13
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
WD40 repeat12.981PS50082
WD40-repeat-containing domain14.766PS50294
HmmSmart predictionP-Valprediction_id
WD40 repeat120SM00320
WD40 repeat0.25SM00320
WD40 repeat28SM00320
WD40 repeat0.00000013SM00320
WD40 repeat1.4SM00320
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-338
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        1016 bases(100 bases per row)
TGATCTACGACATTCAACTGGACTATTACGGCAAGCGTCTGACCACGTGCTCTTCGGACCGGACATTCCGCGTGTACGAAGTGTCAAAGGCCATGGTGGT
AAATGGGGACAGTGACGAACGCTCTGCAGCTAAGGATGAACAAGATCCACAGAAGGAGCCACAACTCCATGTACTACAACACGTGGTACCTCTGGTAGAC
GACTCGGCCGCCCCCATTCATCGCGTGGCGTGGGCACATCCAAAGTTCGGTGCGGTGTTGGCTCTGGCTGCTCAGGATGGCAAGGTTTACATTTATCGGG
AGGAATTGGTACAGCAGGGCACTGGGGGAGTCGGTAACGTGACGGAATGGGGACTGAAGCACGTGCACGAGTTTCACTCACTAGCCGTGCTAAGTGTAGC
CTGGGCGCCGTACGAGTATGGCTTGTGTCTGGCTAGTGCATCGGCTGATGGACAGGTGTCGTTCCTTACTCGTATGCGTGAAGGGTGGGTGATCTCGTCA
AGCTTCCGCAACTCAGATGAAGGTATGGGCTGCACGTCGGTGAGTTGGGCGCCCTACAGTGCGTTGGGTTCGCAGAGACCTCAAGGGCCGATCCAACGTG
TCGTCACTGGATCCTGCAACCACGCAGTTACAATTTGGCAGCTTGCTACTTCGCCTCAGGATCCAGGAAACAATCAGTGGGAAGTTGTGAGTACTTTGTA
CGGACACAACGACTGGGTTCGCGATGTGGCTTGGGCACCGAATGTTGGCATCCCGGCAAATGTGATCGCATCCGGATCGGATGACCACACCGTGCGCGTT
TGGACTCAAGATGAAGCTGACGGCGAGTGGGCGTCTCATGTGGTACATACGTTCCGCGCACCAGTGTACCGAATAAGCTGGTCGCTTACGGGGTCGGTAC
TTAGCGTCGCTGCTGGTGATGATGAGGTTACGTTCTGGAAGCAGCAGAACAATCATGAATGGACACAGATGTCTTCTGTAACTGACCAAGGAGCTGCTAT
AATCACGAGCAACTAG