Transcript Name :
Phyli_Pl_113129
Orientation:
(-)
Number of Exons:
5
Description :
Rab1 family GTPase (PiYpt1)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Small GTPase superfamily0PR00449
Small GTPase superfamily0PR00449
Small GTPase superfamily0PR00449
Small GTPase superfamily0PR00449
Small GTPase superfamily0PR00449
Profile scan predictionP-Valprediction_id
Small GTPase superfamily, Rho type38.841PS51419
HmmSmart predictionP-Valprediction_id
Small GTPase superfamily, ARF type0.0035SM00177
Small GTPase superfamily, Ras type1.7e-38SM00173
Small GTPase superfamily, Rab type0SM00175
Small GTPase superfamily, Rho type0.000000000000016SM00174
Ran GTPase0.000000047SM00176
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-201
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
GTP bindingGO:0005525IEA
GTPase activityGO:0003924IEA
intracellularGO:0005622IEA
membraneGO:0016020IEA
intracellular protein transportGO:0006886IEA
protein transportGO:0015031IEA
signal transductionGO:0007165IEA
small GTPase mediated signal transductionGO:0007264IEA
*** None ***
*** None ***
Sequence
        913 bases(100 bases per row)
TGAACCCGGAATAGTACGTGCAGTTATCTGATTTATTGATGCTGCAGACCAGGTCGACTGACGATGGTCTATGTGTAGTGACTACCTCTTCAAGCTGCTG
CTGATCGGTGACTCAGGTGTCGGAAAGTCGTGTCTGCTGCTCCGTTTCGCCGACGACACGTACACGGAGAGCTACATCTCGACCATTGGTGTGGACTTTG
TGAGTACAACTCAATCCTGTTCCCGTCTGACTGGTCCAGTGTGTCCGAGTTTCTAGCAGATTGCTGACGTGAAAATAATTGTGCTCAGAAAATCCGTACG
ATCGAGCTGGACGGCAAGACCATCAAGCTCCAGATTGTAAGTCAGGATTTTTTTAGCGTTCTGTAACCTTGAGTCGAGCTTGTAGCTAATTATGACAATC
TCCTTGTGCTTTTATAGTGGGACACCGCCGGCCAGGAGCGTTTCCGCACAATCACTAGCAGCTACTACCGCGGCGCTCACGGTATTATCGTGGTGTACGA
CGTGACGGACCAGGAGTCGTTCAATAACGTCAAGCAGTGGCTGCACGAGATCGATAGGTGCGCCACCTCCAGGTGTTCCTAATCAAGAGGACTAAACATC
TAATTTAATGTGTGCTGCTATGATTTGTAGATACGCCTGCGAGAACGTCAACAAACTCTTGGTCGGTAACAAGAGCGATCTGACTGCTAAGCGTGTGGTG
AGCACGGATGCAGCCAAGGAGTTCGCCGAGAGCCTGGGCATTGAGTTCCTCGAGACCAGTGCGAAGAACGCCGCCAACGTCGAGAAGGCTTTCATGATGA
TGGCCGCCCAGATCAAGAAACGCATGGCCAACGCACCTGTGGCCCCTAAGGCCGGTGTCAAGCTGACGCCTGGTCAGCAGGTTCCGTCCAACGGCGGGTC
GAAGTGCTGCTAA