Transcript Name :
Phyli_Pl_113138
Orientation:
(+)
Number of Exons:
16
Description :
hypothetical protein PHYSODRAFT_340865
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Bromodomain0.0000000078PR00503
Bromodomain0.0000000078PR00503
Profile scan predictionP-Valprediction_id
ABC transporter type 1, transmembrane domain40.253PS50929
ABC transporter-like25.87PS50893
ABC transporter type 1, transmembrane domain14.245PS50929
ABC transporter-like24.83PS50893
Bromodomain17.094PS50014
HmmSmart predictionP-Valprediction_id
AAA+ ATPase domain0.000000000000023SM00382
AAA+ ATPase domain4.4e-16SM00382
Bromodomain3.5e-17SM00297
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-71
72-94
95-119
120-142
143-206
207-229
230-720
721-743
744-797
798-820
821-2511
*** None ***
PositionContextScore
678GSNRSIR|SG0.551
1231GKRRKRR|TN0.718
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
ATPase activityGO:0016887IEA
protein bindingGO:0005515IEA
nucleotide bindingGO:0000166IEA
integral component of membraneGO:0016021IEA
transportGO:0006810IEA
*** None ***
*** None ***
Sequence
        34331 bases(100 bases per row)
ATGACAGCTTCAAGTGACAAGCCAAGTCCCAACGACTTGCCCTATGCACAGCTGGTGACTCCGCGAGCTAGCAAATCGAGTGAACCAGGTGTGACGCTTT
TAATCAAGGACGCGACTAGCGATACGAATAAGGATGGATATCTACACGCGACACCATCGCCCACCTTCTCCTTTTTGGATCTCTATCGCTTCGCGACATT
CTCCGACCGCGTCCTACTCGTATTTGCAGTGATCATGGCGGCAGTCAACGGCGCACTCTTCCCATGCATTGCTCTAGTATTTGGTAAGGCTATTGGGGCA
TTTGCTCAAGCAAATGGCGGAGTCGATCGTGATATACTAAACAGTGCATCGCTTGACTACTTCCTTATCGCTATTGGACTCTTCGTGACGGATTACTTGG
CGTATCTGCTCTTCTCGCTCTCGGCTGAGCGTCAGATGAAAGCCCTCAGAGCCCATGCCCTCGAACATATGCTCTATATGGACATCTCATGGTACGATCT
TCATGATCCATTGCAACTATCGAGTCGAATCACCGGTGACACAGTGAAAATCAAGGACGGAATGGGACAAAAGCTAGGTGATGGAGTCAAATACGTGTGC
CAATTTGTGACGGGCTACATCATCGGTTTGGCGCGTGGATGGGATATCGCGCTGGTCATGACATGCATTATGCCTGTGATGGGGTGGTCAATGACCTACG
TGATGAAGAGATGGCGTTCGAGAGCTACTTATGCACAGCAAGTGTATGCAGAGGCGGGTGCTGTAGCAGAGGAAACGTTAGGCTCCATTCGAACTGTCAG
CTCGCTTACAGCCGAGAAACGGGCGCTTGCGAAGTATAACAAGCACACTGCTGAAGTTGAGAAAGGAAACATCAAACAGAGCAGAGTGCTTGCACTCATG
TTGGGACTTTTTCGGGGATGTGACTGGCTGATGTACGCTGCTGGGCTATGGTACGGAGGTTCCAAAGTTTGGAAAGGAGAAACGTCCCCACAACGCGTCT
TCCAGTCACTCATGGGCATTCTTATGGGCATGCGGGCTCTAGGCTTAATCTCGCCGAACCTTACCGCTGTTATCGAGGCTAAGGGTGCTGCAGTCGCGCT
TTACGAACTCCTCGATACGCAATCCCAAATTGATGCATCTCAAGAAGACCAAGGCATCGTTCCCGACTCATGCTCTGGTCGGATCGAGGTTAAGAATGTG
GATTTTGCATACCCCAGTCGGCTAGATGCCCCGATTCTGAGAGGTTACAGTGTCGTGATTGAAAGCGGACAGACTGTTGCATTTGTGGGTTCAAGCGGTG
GCGGGAAAAGCACTATCATATCGCTCCTGGAGAGATTTTATGATCCTACAAGCGGATCCATTCTGCTTGACGGGCGAGATTTGAGAACACTAAATGTGAA
GTGGCTGCGTTCACAGATTGGATTGGTATCACAAGAGCCCGTGTTGTTTGCGACCACCATCGGAGAAAACATCGCAGCGGGTCGGGTCGATTTCACTCGT
GACGACATCATTGCGGCGGCCAAGATGGCTAACGCTCATACGTTCATCATGTCGTTGCCCCAAAACTACGATACATTGGTTGGTGAGAAAGGTATATCGC
TATCGGGTGGGCAAAAGCAGCGCGTGGCGATTGCACGTGTAATTATCCGTGAACCGAAGATTTTGGTGCTTGATGAAGCCACTAGCGCGTTGGACGCCGA
GAGCGAGCGGGTAGTGCAAAGTGCTTTGAACGATCTGATGGATAAAACGAACATGACGACACTGGCAATTGCCCACCGACTGAGCACGATTCGTCATGCT
GACAAAATTGTCGTACTATCCGAAGGCCACGTTGTCGAGGAAGGTCCACATGACGAGCTGATCGAACTCGAGCACGGCGTTTATCGTAGCTTGTACATGA
TCCAGGAAACAAAGGCACAAGAAGAAGCAGAAGCTGTTGAGTTGGCTCTCGCTGAGGCTGAAATCGAGCGCAGGCAGCAAAAGGATGAAACGAACGAAAA
CTTGACTCGGAAAGGAAGTAATCGGTCCATACGAAGTGGTGGATCGAGAAATAGTGCGCGTGCTAGTGTCATTGGTCTGGATGACTCCGTTGTGCAGACC
GATACTCTACACAAATTTACTGTTTGGGACGCCAATGATCTCAGCAAGCCTGAACGCAGATATCTCATCATGGGTATGATTGGGTCGGCGATCAACGGTG
CCTCGTTCCCCGCTTCTGCTGTTCTCATCAGTCAGTTGGTTGCAGTCATGACACTAGATTATGCCAACTACGAGGAGTACGGTGATTTGTCGTATTTGTC
AAGCTTGCCTCACAAGGTGACCGTGTACGGTTGTCTCTACATAGCTGGCGCTATAATCATTTGGATCGGACGAGGTTGTCAGAGCTACGGATTCCAGTAC
ATGGCAGAAAAACTGACATCGCGACTTCGTGGGATTCATTTTTCGTCATTGTGCCGGCAGAATATTGCCTTCTTCGATGAAAAGGAACACGGAACCGGAG
CGCTAACAGCTGACCTAGCGACGGATGCACTGCGTGTCGCCGTAATATCCGGTGAGTCTCAAGGCCGTCTCTTCCAAGCCATTTTCACGACAGCAGCCGC
GTTGCTGATCTCTTTCTTGGCAGGCAGTTGGCTACTCACACTGGTGATGCTTGCTATCATCCCGTTTTTGGTTCTTGGGAACGTATTTCGGTCGAAGGAC
AGACGTGGGAGCAGCATTCTCGCTGATGATATGGCCGACGTTGGTGCCCATGCCTCGGAAGTGCTTAGCAACATCCGAACCGTTGTATCACTAGGGCTGG
AGAAGTCTTCGTGTGAGAAGTTTTCGGAATTGCTGTCCGAGCCTATGAAAAGTGGTGAACGAGATGCACAAGTTAATGGTCTGGCGGTAGGTTTCAGTTC
ATTTATTGTCTTCGCGACATACGCACTTGTGTTTTGGTACGGTGGGAAACTGGTGAATGATGGATCAATCACCTTTTTACAGTTGATGCGTTCGCTGATG
GCAATCATTATGTCGTCACAAACTGTGGGGGCCTCCGTAGCGTATATCGCGGATTCTGACAGCGCGTTTGAGGCAGGAAGTGTTATCCTCTCTCTTCGTG
ACCGACGGCTACCGATTGACTCGTTTCAAGAAGATGGTCTGCGGCCAGATACGATTGTGGGCAAGATTGAGTTCAAGGATGTTCTATTCCGCTACCCAAC
GCGACCCGAGGTGACGGTATTGAAGAACTACAATCTCACCATTGAGGCTGGTGAAACAGTGGCATTTTGCGGTCCAAGCGGCGGTGGCAAGAGCACCTGT
ATCGCGTTGTTGGAGCGGTTCTACGATCCGATTTGCGGTCAAGTATTGTTAGACGACGTAGACTTGAAGCAGCTCAACGTTCGGTGGCTGCGCGGCCAGC
TCGGCCTTGTCGGTCAGGAGCCAACACTCTTCATTGGCACGATCGCTGAGAATATCACGTATGGTTTGGATGAGATGCCAAGTATGGAGGAGATTGAGGC
TGTGGCAAAGATGGCAAATGCTCACGACTTCATCAGTCAGTTCCCGGATGGTTATGAGACCCAGGTTGGAATGAAGGGCGAACAGCTTTCCGGAGGCCAG
AAGCAGCGAATTGCGATCGCTCGTGCGATGCTGAAGAATCCTAGCATCCTTCTTTTAGATGAGGCGACAAGCGCGCTGGATTTGGAGAGTGAAAAGATTG
TACAGGAAGCTCTGGATAAAGTTGTGTCGATGCATCGGCGGACGACCATTATAATAGCGCACCGGTTGTCAACGATTCGTAAGGCGGACAAAATTTGTGT
TGTGAGTGGCGGCAAGATCGCGGAGCAGGGTACACATCAGGCGTTAATTAGTCGACGCGGAATCTACGCAAAGCTTGTGGAGACGACTTCTGCATAGGGA
TACACCGTAGTTGCAAACATTACAACCACAACAACACCGTATTTCCTAATGTAAATTGTCCTCCAAGCGTAAAACTATCGTTATGACATCATTTATGTCA
ATGGAGAGAGGCGATTGTTCACTTCCTTCCTCAAGTCTTATGTCGAGGGCTCTGAGTCAGAGTCTGACTGGTGCAAACGCATCCGTTTCGGTGACTCAGT
GCGACTACCGATACACACTTGCAATACGGCCAACCAGTAATCAATGATGACTCTGTTGACAAATGACGTTTGTTGGTCTTTGAGTCAATGGTTGATGTTT
TAGTGGCATTCCAGCACCACAGAACGTCTGGAGATGAAACTTCCACCTCGTCTCAATACTGATACCAAGACGACATTACAGTGTATCCTTTTCAATGAGT
CATTGGCAAACAATCGGCATGTTTGGCTCGAGTGTACGTGTCGAAAATGTAGCCATGTCAATGACAAGCATCGTATTTAGTCGCGGCATTCTCCAATTCA
AAGAATCGTACCATACAAAATCCAAGTCTATTTCTGTTATTTCATGTGCACCACACTGATATTCCATAGGACTACAGTCGGCGCCATTTCGCGGTTTGAA
CGCAAGCAGAAGAGCGCGCTCCTGCCGCCTCGTAGTTGCTCACCCGAGCCCAGCACACTCTAGACCCGCTACTGTTGCTTCGTGTGTCTAAGTTCGAGGC
CCATGGACAGCGGCGCCTCTGAGTCAGGTGCGTTCTCGATAGATGTACGAATGGCAGAGGTTGGCCTCTCCATTTTTACTACTTTTTCGTGCAATTCAAG
TGTTAAAACGGTTCTAACGCTGATACCATTGATTTTAATGTAATCTATAGCCGATGCGTCCGCCACTCAGCAGGAAAACGTCCCAATGACGACCCTAGCC
ACCGTTGAGACTGCTGTGCAGAAGATTAAGACCACAGAGCCTGAGAGCAGTCCTGCTGAGACTGGTGTGGTGAAGACTGAAACTCAAGTGAAAAGCGACG
ACAATGGGAAGCGTCGTAAGCGCCGCACAAACATGAAGAAGGTGAAATATGTGGAGGACGACGACGTCTCAGAGACAGAAGAAGCTATGGTCGCAGAGAA
AAAGAAGAGAGCACAACAACTTGACTACCAGTTGAGAGCAGTACGTGTTTGCTGTTCCTACGTGAGGTGTCCATTGATATACTGAGTTGTGATAATGCGC
TATTGTAGGATGTGGGTTACCCGCTACTAGACCAAATTGTGGGGCGCCGTATCAGTGAGTCGACCGGACTTGTGGAGTACTTGTGCAAGTTCCTTGGTCG
TTCGTATTTGCACCTATATTGGCTTACATTTGACGAACTGGAGCTGTTTTTTCCTGAAGGGTACCAGAAGTTCCATCGTGTGCACGTCTATGATAAAAAG
CTAAAACGCGACGGATATCAACCACTGGATGAAGTAGACGATCTGGAGGCTAATAAACTGACTGTGGAGAAGATATTGAACCACAAAGTGGACCCAGCGG
ACCACTTAGACGAACAAATTGAAAAGCGCCGACGTCAACTGCCGTACGAGCCAAAGTTTCCACGCGTGACAGACTATTTCCTAATGGATAACGCCGACGT
CGTTCCAGAGCGCATGCTGGGAATCGTGACAAAGTTGACGAAAGAACTCGGTGGTGATATCTTTCAACAACCCGTTGATGTTGAGGAGATTCCCGACTAC
CTCAATTTTATTACAAATCCTATGGATCTTGGAACTATTTCCACGCGATTAGGTCGGGAAAGTTACTACATTGGACCGTCAGCTGTATCACTATTTGCCT
CGGATGTGCGGCTGGTGTTCCACAACTGCAAAGTGTATAATGCTGAGGGATCAGATATCTGGCGTGTTGCAGACGTGTTGCTACAGACTTTTGAGAAGTG
GATGTACGACTGGGTATTATCCCCATCTGCGTGGCTGAAGCTACCAACTTCAGGGGACGCAAAGGAAGACCAGCGTCTTCTCAAAGAGTTTCGTGCGGAA
GCAGAAGAGTTTTACGATGTGTGGGCGCCTTGGCGTATCGGCTGTTGCGTGTGTGGAAATAATGATCACAGCGAGGAGCTGTTGCTGTGTGACCGATGTG
ATGGTGAGGTTCACATGCACTGTGCTACCCCTAAGATTACGGAGTTGCCAGAAGGCGAGTGGTTTTGCGCGTACTGTCGAGCACGGGCAAAGTTTATTGA
GAAAGTGGAAGAGAATGCTGAAATCACCCCGAAAACTATTGCGACAGAAGTTCCTACTGTTGTATCAGCTGGAGCTGTTCCATCAACCTCCAATTCAACG
CCTACTTCTAAGAAGACGGCTACTCTATCTACGCACATTCCTAATATTCTTATGGATCATGCTGATGGTGAAGGTAAAGTTAACAAGAAAACGTCGAAGC
GCAGTCCGAAAGGCACCAACACGACAAAGAGCTTGGCACCAATCAGCATGAAAGATCGAGCTGCCACATTTTTCTTGGTAAAGTGGGTTGGTTTGTCTGT
TCGATTCTCAACTTGGGAACGTCCAGAGGATATTGGTGATGATGAACAGATCCAGAGATATTTCAAGTTCAGCCGTGTGCCTAGCGCAAAAGAGATTCGT
GAGACCACATGCCAGCTGCCATGCTGCGCGAAGAAGCACCAGTACGCTTTAACAACCAGCACAAGTGGAAACAGATGTTGTGAAAAAGACCGCTTTTGTA
CTCTCGGGTATGGCCATGAGGGTGATTGTAGTCGCAGTATCAAAGCCATGGGAGGGACCTACGGCAGCAACGCCTACCAAAGATTGCACATGCAAGAACA
AGTGAAAGCACAGTTGTTTGCCTTTCATTGTTTACTGAACAATCATAATCCCGACAAAGATGTGCTTAAGCAGTGTGGTATGTACACGAACGCATTCGTG
ACCACAAAACAGCACTTGGCACCCAAGGCTTCCAAAGAGGATGACGACGAAGATTATTCGGATGAAGATGGGGATTCATCTGATGATGATGCTGACTTTG
ATGCTGAGATTGATTATCCGAATCGACCAGCTCTATATCCAGGAATCCTGACTCTGGAAAATGACGATGATGATGACGATGACGAGAGTGGAGGGCACAA
AAAGAAATCAGGACAAGAAGTTGGCGAAGTTCTTAGTTCTATTGTTGAGCACGTTGCCCTTGGATACCCTACTAAGCTGGAGACAGTCAGCGCCGAATTT
CGTTTTGACTCGACATATCCAGCGAGATCTTTCAACGAGCTTCCCGCCTTCTCCGAGTACTGCGTCATTTTAGGTCGATCGCCTTTCGGTTTAGGTATGC
GTCTTGGAATCAGCAGTACCAGCAGTGTATCGGTTTTGGGATTCCAGGTTCTTGCAAATGGTATGATGGGGCCAGCCCAGGCGTCTGGAGTTATTTCCAT
TGGTGACGTGCTCGTTGCCGTGAACAACACATCGGTCGCTGGGCTTTCGTTTCAAGACGTTGTCGGATTGATCGGCGCGTCTCCCAGCCAAATTCTTTTC
TACTTTCATTCCCCTCGGCCGGCTTTCATGTATCCTCCCTATTGTCAAGCAAAACAGGTGGCAAAGATTCGTCTAGAAAAAATTCCTGATGATGCGGCTC
CAGAAAACTCGAAGTATGCAGATTACAGCTATAACAAGTACAAACGAATGCTCAAAGTGGGAGTTGCAGATCCAGATGTGGCATCGTCGGCTTCGACGCA
GACGTTGATGCAGCATTCGAACTACATTGCGCCAAGCGGCCCCATGCAACATCTATACGCAGGGGTCGTCGACAACAGTATCGACCCACACGACCATTTT
GCGAGTTTCCTTCCAGAGCGGAACAGCTCTGCCGGTGGTGGATCACGAGACAAGAGTAATGCGAGCAAAGATGGAGATTCAAATGAATTTGTACCGTATG
AACAGTCACCAACATATAAAGGTGGCCGCACGCTGCGTGCTTATCAAGTTGAAGGTCTAAACTGGATGGTGTCATGCATCAAAGCTCAGCGATCGTGCAT
ATTGGCTGACGAAATGGGTCTGGGTAAGACGGTTCAAATTGTGTCCCTGATCGAACACATGAAGTCAGAGGATTCTATTCGTGGGCCGTATCTGATTGTC
GTGCCCCTATCTACGATTCAACATTGGCGTCGTGAAATTGAGAGCTGGACAGATCTTAATGTTTGCGTTTATCACGACATTGGCGATCGCACCACCAAGT
TTACTGCAAAGGACATGCGTGCAGTTATCCGTGGACAGGAATGGTACTACCCAGGTTTGGGCAACTCAATCTTTAAGTTCCACATCCTATTGACAACATT
TGAAACAATTCTGGCGGATTTCGAAGAGTTTGAGCACATTCACTGGCGCTTGGTTGTTGTGGATGAGGCACATCGATTGAAGAGCGCTGGATCACGCGTA
CTGAAGATGATGCGTGTGCTCCACGTTGATCGCAAGGTATTACTGACTGGTACACCTTTGCAGAACAACACACAGGAGCTCTGGGTCCTACTTAACTACC
TAGAGCCAGTAAAGTTCGCCAGTCTGGAAGAATTCAACAAGAACTTCGGAAAGCTCCATTCACAAGAACAGGTCGTCAGGCTTCAGCAATTGTTAGTACC
TTACATCCTACGACGCGTGAAGGAGGATGTCGAAAAAAGTATTCCACCGAAGGAAGAAACTATTATTTCTGTGGAACTTACGACGCTGCAAAAGCAGTAC
TACCGAGCCATTTATGACAAAAACAAAAGTTTCCTATACCGTGGCACGAAGAATGGTTTGCCGACGCTGAACAATATTCAACTGCAATTGCGAAAATGCT
GCAATCATCCATTCTTGATCAAAGGTGTTGAGGAGCGAGAACTAGATGAACTCGGTGACAAGCCGACCCCGGTTCAAGTGATGGAGAAAACAATCGAATG
CTCAGGCAAAATGATGCTTGTGTCCAAACTGATCCCGAAGTTGAAGCGGGATGGACACAAGATTTTGATCTTCAGCCAGTTTTTGAAGCAACTTGACTTG
CTTGAGCGCTACTGCGAGGCGAATTCTTTCGTGTTCGAGCGTTTGGATGGCTCTACAGGTGGAAGTGTGCGTCAGAGTGCTATCGACCGTTTTTCGAGGC
CGCACTCAAAGTCTTTCATTTTTCTGCTTAGTACGAAAGCTGGTGGTGTTGGTATCAATCTCATTGCAGCTGACACAGTGATTATCTTCGACAGCGATTG
GAACCCGATGAATGATCTCCAAGCCCAGGCACGATGCCACCGCATTGGCCAGAAGAAGAGTGTACAAATTTATCGCCTGGTAACCCGTAACACGTATGAA
AGCGAAATGTTCGACCGAGCATCACGAAAACTTGGCCTTGAGCACGCGGTATTAGGCACGGCGTCTTTCAACGAAAATTCGCAGATCACGAAGCCGTCGG
CGGAGCAGCTTGTCGAGCTGTTGAAGCGCGGAGCGTATGCGCTAATGGAGGACGACGATACAGCATCTAAAGAATTTGCTGAGCGTGATATTGAGACTAT
CTTGAAGGAAAACGCTCGTGTTATGGTTGTAGGCGGTGGATCCAATGCTAACAAGGGGGCAGAAGGCGACACGAGTGGATTGACATCGCCAAAACAGCGA
AAGTCTCCGATGAAATCGCACAAGCGAAAGTCACTTGGTGGAATGGCGGTCGATCGTTCATCCTTCGTTGCTGAGGGAGCGACTGGCGAGCTATCTGTGG
ATGACCCGAATTTCTGGGAGAAGGTTCTTCCGGGAGCTGTCTCGGTGGAAATGCTTAGCTTGAAGCTGGAAGATGGGAGTGCTGTGAGCTCACGCCAGTC
GAAAATTAAGTTTATTAGCAATTTAGATATTGCGCTGACGAGTTTGGTCACCGAGATGAGTTCAGGCAATAATGTTGATGATAGTCGCGTCGAGAGTCGA
GACATTCAGCACGAGTACGATATTGCTATCCAGGTGCTGAGCACCGTCAGTTCAAAGTACCGTGAAGAGTTCTCCAGCGAACAGATCGATCTCGTGAAGG
GATACTTATCAAAGCTGGAAAAATCACGCGTGCGAAGCTGCCGACTAGCACCGTCTCGAACAAACATGTTCCAAGATGAAGACTTTGATACGCCTAAGAA
GAAAAGACGAAGGAGGAGTACCCCAACAGGCAGCAGGACAGCAAGCAGCGAAGATGAAACATACGGCGACACTCCTGTAAAAAGGAGGGGCAATAAGCTT
CGTGGTCGACCGCCAAAGCACCCAGGAGGCGAGGATGCACAAACACCAACTGCACTCTTTCAAGGTGGTGTTATTAACGACAGTGACGATTTGTGCACTC
TTTGTGGTGATGGCGGATTGATTTTGCTTTGTGACGGGCCGTGCCATCGCTCGTTCCATCTCGAGTGTGTTGGTATGAAAGATGAACCAAACGATGAGCG
GTGGTTGTGCCCGGATTGTGCTGAGGGACGTCATATGTGCTTGGTTTGCAAGCAGGTCGGTGAAATGGGTGTCGAGTTTGGTGTCACACAATGCTCGGTA
GCCAAGTGCGGTAGATTCTACCATAAGGGCTGCCTTGCCAAGAACTCGCGTGTCGAGTGGGTTGGCAAGAAACGCTTCCGCTGTCCTAGCCATTTCTGCC
ATGCTTGTTCACAGACCAGCAAGAAGCAAACTAAGGTGAAGAACAAGAAGAAGAGCGGCGACAAGATTGGTGTATTGTGCTGTATTCACTGCTCACAAGC
CTTTCACCCTGATTGCATGCCGTCAACAGGCAAGTACATCCGTCTTTCGAAGAACCTCATGATTTGCGCAAGTCATTTAGACGGAAAACCCCCACCATCT
TCTGCAAGGAAAGCGACTTCATTAGGATCAAAAACGGGTCCAAACCGCGTTGGTGCTGCACTCGCCGAGGCAGCAGCACAGCAGCGACTACAAGAAGTTC
CACAACAAATTCCTCTATATGAAGATGACAACGTACAGGAGCCTGGAAAGGCAAACGGCAAGCGCAAGCGTGCATCGTCTCCGAACAGACCCAGCTTGAA
TGGGTCCAAGAAAACCAAATCCACGCATTCAGGCAACGCGACTACGAAACCCAAGGTTTGTGCGCTGTGCCTCCGAGGAAACGTGATGGGAGGTGTCGAT
GACCAAGAATTGCTACCTCCGCCTTCGCCTAAAAAGGGAGCACGCAATGGAAATGCAAATACAAGTGCAGACTCGGTGGGGACAGCCACTGCCGATATGG
CTCTCGAAGGCCCTTTTATCGAAGCTCCTGTGCGCTTGAAATATGCTGACAAACCCAACGAATCCGTGTATGTACACTTGAACTGTGCCGTGCATTCGCC
TGAGGTGTACGTAAAGGCCGATGGTCTCATCATGAACTTACCCAAGGCAATCAAGCGTGGACGGCAACTCAAGTGTACCAGCTGCCACAAGTTCGGTGCC
ACGGTGGGCTGCGTCGTAGCTAAATGTCGGCGCAACTACCATCTACGTTGCGCTGTGGAAAGCGGCGGTGAGATTGATGGAACTACATACGCCTTGTACT
GCAAGCCACATGCAGCTGCACGCAAGGAACCGACACGCGTATGTGTGTGCGATGGCAATGAGGAAGACGCGACACTCACGCTGGTGTGTTCATCTTGCAG
CACGAAGTTTCACCCAAAGTGCGTGAACATGTCGGATCGTCATGCAGCTCGTATGGCGAAGACGTGGATCTGCAGTGTGTGTGATGGCACAGCTGCAGCA
ACACCAGCGACTCCAACTCACTTTCCCCCTTCCAAGTCGAAAGCGGGGACGTCAAAGAAATCGACACAAAAGGCCAAATCTAACAGCTCAAAGGATTCTG
TAAAGACAACTACCAAGGCAGCAGCAAAGAAGAGTAATGACAAGGCTGAAAGCGTCGATGGTAACCAACCATCGCCGAAGCGGAAGAAGGCGAAGAAGAA
CCGTCTCAGTATGCCGCGGAGCAAGTCTCGCCCGAAGACGAATGGCACTCCTCACGGAATTTCGCCGCATATGGAAGCCGATTCGGATAGCGGTATCTCC
ACGGACGAGTAGGTAAAAGAAGAACGAATATATGGTATGGACCCAACGTATATTACTGAGAAAGATGACACAACTCATCACTGAGTCGATAAGCATCTGT
CTTATTTGGTGAAATCCGATAATGAAGATGAGGCTCTAAGTTCTTCAATGGGAATAATTGCCAGCATGTTACCTAAGACAAGTGGTCAGTTTAGAACCCG
CGGGTTGTCGATATCTTCAAGAGGGATGAATTTGTTGTGATATTTTACGCATGGAGGGCTGAGATTCCTACAATGTCGTGTTCTTGGAGTATTTGAAAGA
ACGTCCCTTTTGGACAATCTTGGCGGCATGAAAACAAAAGTACGAGCTGCTCATTTACGCTTGCATCTACAGTGGCGCTGCAGCACTATTGTAGGAATTC
ACTCATCACCACAGACCGCTCCCTACTTCATTATTACCTCAGTGAGCCATCGCCAATAGGGAGGTAACCTCACTTTGGGCGATGGCCTTCGGCAGTACCT
CGCATCGCACGGATGTGCTGTAGTGAAACCTTGCATACAATCGTGGCGTTTACGACTCGTCGACTCTTCGGCGTCTCATGCAAAAGTCTCAGTCCTGCAT
TAGACAGGAGAAAGCACAACGGACGTCAGCTGACGTGGTGAAACTTCGTCCACAGCTTGTCATCTCGCTTTGATTTACATGTTAAGTTGATTCTTGTCCA
AAGACAACCTTTTATGCACATTCTCCTGAATCAGCTCTCGACTTCAACGTCGCTGTCATGCTGTTTTGTGCACACACAAAACAGGGCAAGCCTTGTTACA
AATAGTGCAAAACTACATGTCAACCGATCTCCAACACACAGAACTTCCAGCAGTAATGCAGAGGACATGGCGACGCAAACGGGGACCTGTCAACGACGCA
AACGGCAAATGGAGCCCGAACGGATAGGGGAACCGCCACCGTCGACACGAAACGCTAAGTGGAGACCACCGGCTCCGACAGATGACAGGGGAATCAATCA
CTGGTAGCGACGCACTTGCAGTCTGCAAGCCGCCAAAATTCCCTGCTTCGACGGGCCTGATATCGGCAATGACTCACTTGTTGCCGTGGATCGAAGATCT
CCGTCGAATATCTGAAATGACGCCGAAAAAGAAACATCTTATCCTGAGCTCTACGATTTGATTGGGCCCTGGAAATTCGATGTTGAACTCGACCTGCAAC
CGCTCGATGGACTCGACCGAATGCCCCGCACAGACAGCAATTGCAGTAAACTAGCTTGCCAGTGCATGAACCCTGTGCGCTTCAGCCCGGGTATTGCCGA
ATCGGGAGAGACGGTTGTTTGCCTCTGCCATTTGTTAGGGCTGGTAGTTTGGATTTGCAAGGCAATGTCTCCGTTTAACGTTTACCGGCGCGCTTCAGTG
CACTTGTAGCTAATGTTTTCAGAGTTGGGCTTCATGTTGCATGGGAATCCAGCTGAACAGTGCAAAGGGTAAGCCCACCCGCGTCCGAACTTTAGTGGTC
GAAGTCGGCTTAGTGTTTGGTGTGGACGACGCTGGCCTCTCCTCTCCCCCGCCTTCGCCTGGTTCCATTCTCCAACTTGCTCTCGACGTACTCGGAATCG
CCTGCAACACGGCATTTCGTTTCTCAACAAGAAGTTTCGTCGTTCAGTCACACTCTGCTAGTGCCAAGAGCAGTCGGAGTGCGAAGGAGCAACTGTGTCA
ACGAAACGGAGCTCCAGTCGCCACCAACTGCAAACACCACGAAGCGCTCCGTCTCTCACCAGCGAAGACTTCCGGCAAAGTCTCTTCGCTGGTACAATCC
CAGCATCTCCGTTTCGCCACCTGCGCACTCTCCAATTCGTTTACCACACGCCAAACGCCACACTGCCAAGAGACACAAAGTGCGATCCGCCACGCTGCAA
CAGGCAACCACCAGCAAGAAATAATCTCAAAGAACACAACCAATCAGCAACAACACACCACCCACTACGATGCCACTTTCCATCTCCTTTTACCACAGCA
AAAGGGGAGAAAACGCAGCGAGTTCGTATCAGAGTGTGGCGTTGCACGATCGCGAGAAAGTGAAGCACAAAATGGTGTTGCCTTGCGAATTCTACCGCAA
CATTTGGGGACCGACAGAGGAAGAGGACGCAGCACTACGTCGTCGCGCCAGATCCACCAAGTTCAGCCGGTCCCCAGCCTCGACAATGTCAAGGCGGTTC
AAGAAGCGAGTGGCAACAGGTCCTCTCGTTGACATTGCGCAAGTGGCTCACGTTGTCACGACCATGTCGGACTTTCGAGCGGATTACGGCGAAGACTCGA
AGAAGGTGAGACTCGTCAACATTTGGGACGACCGCAGTCTTGCATTAGGTTTAGAACCAGAGTCTTCATCCGATTCGTCAGACACTCGTGGCAGTGAACA
GGGGCCTTCCACTGCTGACACGGAGCCGGAGGAGATCATGTCTCCCATTTACAGTCGTGCAGACAGGATCACAGAGCTCAGCTGCGAAGACAGCGACGAC
GAGCTCAGCAGCTTGGCGTCCTCAGTAGTCAATCGATATCGGCCAGGGGAGTTGAAGAGAACTCAAACTCCTGAAGTTGTTTTCCCAAGCATCAAGAAGA
ACGCCAAGAATGGACAAGGTAGTGGCAAATCGGATAGAAAGGAGCTCAACTTGAAAAACTTGCCAGTTCCTCCTCCGTCGTCACATAACGGTAGCATCAT
TTTTAGTGCCGTGTTCTCGGAACAGCGTGACTGGAGCTGGAGTGCCAAGTTTTTGCTGGGAATTCACGAACCAATTCGCCATGCGCTCTTTGTCATGGAT
CGGTTCTTGGAACAGTCTCAGAGTCAATCGAAGCCTGAAGCTACAGATACGTTGGCATTAGAGACGCACGTAGCAGAGTTTTTCCTTTGGTTCAAGACGT
ACTTCGTGGAGTATTTGCTTTGCCAACACGAGATGAAGGCATCTGTGTTACTTCCACTTCTCAACCTTCCAGTGTCGACCAAGCAGCAGGTATTGGATGT
GTACCAGGATATCAAGCAAATGTTGGCGCAAATTCAACAGCTAGAACGTGCTTTATGTGTTAGCGGAGCTTGCAGTGCATCGTCTTGGCTGCTTCGGCTT
CAAGTGTTGCAGACCGAGATCAGACAGCTCAATCGTACGCTACATGCGGCGCTGAACATGGAAGAAACGACGTTGCACCCTGCCATGAGCGCTGCATTTA
CTGAGCGAGCGTTCAGAAGCCACATCATGCCGCGAGTTTTCCGCGCCATCCGAGCCAAGCGTGTTGTTGTGCCGTGGATTGTTGAGCGCAGCAAGATATG
GGGAGGGGAAACTGAGCAGCGCACCATCCAGGGGATGCTGCCCTTCTCAGCCAAGTTCATGTACCGCAAGATTTGGCGACCGTACTTCATGAGCAATGTT
GCAGTGGCGATGAAGAACCTGAACGAGTTCGTTAGCTCTGCGGATTCGAACAGCAGTGCTAGTAGTGGTTCGACATACAGCGAACGCCATGGAGAGATGT
GCACCGTCATGTGAGGTGGCGGGCAGTCTTTCGTCCTCTTTTCCTGAAAGCTCTACTGCTATTTATTATGGATCAACTATCTAGTGTATCGTGGCGTGAC
CTAAGCTAGCAGAGCTAAAAGCCTAAGCAGCGAGTAGAAGCAGCTTACTCATCGTGCTAATGAAAATGCTTTCTAAATCGCTCAAAATGCGACCCATCCT
TTCCAGTTAACATGACGGAGGAAAGCCCAGTATCATCGCATGAGGAGTGTCATCAGTTTAATTGAAACGATTGATTTCCATCGTTCGTTTCATGATCCTG
TCGGTTGCATCAAACCCCCAGCGGTGCGCCAAGGAAACAGTGATCTCAGTTCAAGACAGCAGACGAATCACCATGACAGCTAACGAGAAAAATCAAGTAA
AAATTGCGACGGATCTTGAGCCCCAGCAACAAACGCCTCGCGTCCAACTGAATAACGTCAAAGGCGGCAACTCTGATGCTGATTGTCAACCATCCTCCAT
GTATTCGGAGGCGCCTCGAATTGCATGGGACTGGATCTGCTGGTCTGGTGCCAAGACGTTCGACGGCATGGACTTTGCTGGCGAAGTGTTGGCAAATTTC
TTGGGACTCAATCAATCCAAGTATCAATGGATTATCGAAGCTCAAGCACGCGAGGAAGAGGAAAAACAACAACGTCGCCTTGAAAAACGTCAGCGCCGAC
AGATTCGTCTAGAGCAGCTACTGGAAGCTGAGCAACGCAAACTTCAGGAACTGGAAACCGGTGCACTTGAACAAGATACCATCATAATAGAGAAACCTAG
TGAGGTGTAGAAGGCTCGCTCACATATGAGTGAAGTCTATTGCTGAGCAAAGGCCACACAGGAACATGCACCACCACATCGGCGATAGATAATCACCAAC
AATGCCATCATTGCGACATACCCGTCTTGCCATGAATACTCATGCGTTGTCCTTGGTCTTGATGCTATCCCAAAGTGGATGTGTTGGCGGCTTCACTCCA
GCACGCAATAACATTCGTACAGCTGCTTTCTCGATGCGCTGCAGTTGTCGATTCACAACACTTTCACTCTCAGGTGTAAACTGTTCCGTCCGAATTGTAA
GTAGCCCTGCACAATATCAACCCACAATGTCATGTCTCCATCTCCACAACAGGACCATCAACCAAACCAAACATCTCACCATTGAGGTTGCCAAAGAGCA
CGTCCGTCGAGTATCGATCGCCAATCACAACAAGTGTCGCTGGATCTACTTCACCAAAGTGCTTTGTCACGAATGCAATACCTCCAGGTTTCTGGAAGGA
CAAATACATCAATTTTAACCTCACGTTCGCAATAAACTAATCCAGAACTGGTTATCAACACCTTCTGATTGTGTCGTAGTACAGCAACATGCAGTTCTTC
CTCGATCTTCTTGGCCTCCACTCCATCCTTGTCGTCCGTAGACCCAGCCGAGTTGGAGAAAATCACAACACCCGAATCCCCAAAAACTCGACGGCATTCA
CTCAGTGAGGACTCGAGATGAGGATCAATCTCTAATTGATGCGGCACCGTCAACGTATTATCCTTATCAAAGATAACGCCGCGGAACCCGCGGTCTCTCA
ACGTCTGGAACGGCACTTCCGTCACATCTGAGGACACAAATGAGCAATTCGTAACATATTTTAGGTCAGAATTACACCTTATATAACCATAGAATGATTG
ATCATTTTACATGCACAAGAAGAGAAAATCAATGAGATCACCTTTCACTGATAGCTGCGGCAAAAGTAGCTGCGGTTGGCGCGCCAGAACGCGGCAAAAC
TCGACCACACCGCCAAGGTTAAGGCCTTTCATGCTCGTATTGCCCACTAAAACATTCTATCCAATCGCATCTCGTTACAGACAATAAAATGCAATCATTC
GTCAAAAGTTTTGAATTTCGTCCAATCATCAGACGAAGCCGTTTCGACAGCCAGTGACGAGCTCAGAAATACTCGCTCCCTCACTGGGTATCGCTCTCTG
GGATTCGCGTCGCCGTGACATCCTCTCTGCGTCTTCATCTACGACACCAGTCCTCCGACATTCTTGCTCTGTGTTTCACACACCTAATACCGTCTTTTAC
AGTCCTAAACACTCAATAATGGCCGAGAACCCGCAGGAAACGCACGTGGAGGAGGAAGAGGACAAGAACGACAACTCGAGCTCCGAGGACGACTCGTCCT
CCTCCAGCTCTGGCTCCTCCTCTTCCTCTTCATCGTCTGATTCGGAGTCTGAGGATGAAGCGGAGGAGAATGCCGACTCCGGAGCGAAACAAGGTTCTGC
TCAAGGAGGCATCAGCCGCACAGGACCCGGCTACTCTGGCAATAATTCAGGACCGGCACTGTCTGCTCCTCGTCCACATGGACTGGCTGCTAATACTGAG
ACGCTTAACGTCAATTCGACGCGAGCTGCAGCGAGATTTAAAGCTTCAGAGACAGAGGCGATGATGCCGCTTGGCACACGCAAACGAGATCGACGTACTA
TTGAGGAGATTCAAAGAGATCTACGAGACAAGAGGAAAAAACCTTTGAGCACTCCAGCTGCCAGGTCGAGTCCTCCTCCGCCAAAGGGCTCACCCGTGCG
GTCTCCGGAAGCTGAAGCAGTGGTCAATAGTGGAGCTCCCATGGCTGTAGGAGGACCATTGGGTCAGTTTGGAACTACCGGACGACTGCCAGTTAAGAGA
AAACCAGTGTCGGCACATGATAGATTGGCGATGAAACTCAATGGACGCAGAACGACTAGTGCCAAGGTGAAGAAGACGACCAATTCAACTGCAGGAAGCG
GAACGATCCCACCAGTGTCGGTGATGACGAACAAAACTGTGACTAAACCTATGACTGCAACGAGTTCGGTGAGCATGACGACAGGAAATAGCAGCAGTAG
CGAACATGGAGGAGATAATGGGGGCGATGGATACAGTAGCAGCGTCAGCAGGTCGTCGGCACCTGTAGTAGACGGCAAGGCGGTGCGTGCGATGCTGCGT
GCCATGCTTCGCTATGGAGACTTGACCGATGTCGGACTCTATCCTACAGCTGCCAATTTTGCTGATGAGTACAAGATGCCCAATTTTATTGAGCGGTCGA
ATTTACAAACGACAACCAAGGCTTCCATCGATCGGCTGCATACTCTTGCAAATGAAGTTGCTCAAAAAGCTAAACAAGCTGTAGAGGCACGGCCTCCGCA
TGATAATATCAAGATCTCCGAGGTTGAGGCAAGGTCGACGCAAATTATTGAGCGCCTGTACGAAAACCTGAAACTTCGTGTCGCTGTTCAACGTGCCTTG
CGTACTGCTGGATGCTCTTCGGGCAATGCTCAGGCAAATGCTCAAGGCGCATATGTGTTGGTGGCGAAACAGAGCGATCTTTCTGTTCTGGGTATAAATG
CACGGGACTTGCCAAACTGGACTTGGGCTGAAAAAGAGCACGATTGGTCGCAGCGCAAAGATGCAGCGCTACTTCTTGGCGTATACGTGCATGGATTTGG
AGGCTGGGAAGACATCCTCAACGATGATTTACTTCATTTCCAGGGACAACGAGCTTTGAAGGGTGAGCGTCTTAAGAAGCGCGCTGAAAACCTGTTGAAG
CGCTTACCAGCGCCTGATCTTGATGCTGGCGATCCACGCATTGTCCAGCAAGCTAGCTCGCTAAGTTCTACCGGCACGAACTCGAACCAGTCTTTGGGTG
CACAGTTTAGTGCGATTATCCACAGTGGGGCCATTCCTGGTGTGACAGCATCAGTTCCCACTAATTCAGGCGCAGTTGGAGGTCGAATGGCTCGTGCAGC
AGAGCGATTCGCTGCTCGACAGCAAAACGGTGACGATGTTATCGGTCGTCGTCGTATTGGGTCCAGCAACGGTACAGGGACTTCTAATGGTGATGCTGGA
CGACAGCACAAGACACCGGTAATGAGATCCCCAGCGCAATCCAGTGTGATTGATAACGAACCCGAAGAGGGCGAAATTGGCGGTGCTTCACCAGCTCAAT
CAGCACCATCACAACACAAAAGGCGATCGTCATCAGTGGATGAAGAACAGGCGTCATCCCGTAAGAAACACCGCAACAACAACAGTGAAAGTTCAAGCAA
GAAAGAGAAGAGGAAGAAAGAGCATCGACGAAGCGACCGTAGCGATTCGAAAACCATCGCTGAGACACCAGCGATGGTCACAAATGTGGTATCAGATGTG
GCCCCGTTGCCTCTGCTCTCTACTGACGAGTGTTATGAAAAGTGGAAACCGAACAAAAAGTTGCGCGAAATCCGGCAGGTACTCAAAAAGATGAAGATAA
TGGCCGAGTGGTCCCGCAACCAAAAGGACGAGACTGTTGTGGAGAAAGTGTTCAAGTATGTGAGTACGATTGGAGAAGCCATTGATCGCATTGTAATGCA
GCACCAGGAAAAGGATGAGCATAATTCAGATGCGTCGTCTTGCGAAATCGATGAACTCTGCACGTGCTTATGGACCTATGCCTCGGGCTTCACTCCTTTC
ACTCCACAAGGATTTGAACGACTCTACGATGATATTTGTGCCGATGGCAACGCTCTCGTGGCGACTAGATCGTGACACATCTCACAGTTTATCGCAAAAT
AAGTGTGATGTCAAAAGTTTTCCAGCAAGTGTATGCACAGGGAACAACCAGGAAGAGATAAAATTATCAACATTGTGGACGAGCAACATTCGTTGATTTG
CGCTTTTGGCTCTTGTGCAAGATGAAACCCCCCTCATGAGGGTCGCGTCGGTGCTACCGTTGCACAGAGTAGTTGCGTAGTTGCAATTCGGAGCATCGTA
GTGACTGACCAATGTTGTCCGTGTTACAGCCGCCGCCCACGGCGGAGGAGCTGGCCCTAAAAGACCAGGTGACACAGGTGCTGACAAGTCAAGGGGTTCT
AGCCAAGCTGAAGGCAGAACTTCGAGCCGCTGTGTTTGAAGTTATGCACGAGCGCGAGGGATTCGTGAAAAAATATACCCTAAATGGTCCAAAGCTAGAT
GATTTCCCTATGGAGACCAGGACAACTGCATTGTCTCTGATTGTTGAATGCCTAAAGTTTTTCCATTGGGAGAATACTTTGCGTGTACTACTTGCAGAGA
CCAATACAGAAAGTGAGCAACTCGACAGTGCACTTTTGGCCAAGAAGCTTGGGTTGGTGGGTAGCTATTCCTCAAGCAAACCAACACTTTTCCATCTTAT
CGAGTCCAAGATGGACAACAGTGATCAGACTCCAGGATCTGGTAAAACATTGCCAACTACGAACTATGATGACTTTGATGACGACGGGAAAGAAGCAGAT
CAACCAGAAAGTATATCATTACCAAAGTCAAAACAATGGGAAGAAATCGGTTCCCGAGAATCACCTTCGAAAGAGGTGAAGAGCACACAGCAGACAACCA
AGGATGAAGCCAAAGATGAATCCAAGGATGGAGATGGTGAAAGCAGTGCGGAGATAGAAGAAAGCATGGCGGAAGAGGTGCCAAGTGGGTCAGAACTGGG
AGAGTCAAACTATACAAATTACGATGATGAGAGCCAGGATCAAAGTGCCGTGCATGTAGCTGGTCCACAACCCACCACTCTTTATGCGAGTCGATTACAA
GAAGAATCTGAAGGCGATGATAAAGATCATGACAAAAAGGATGGTAACGAAAGTTATACTGAAGTCGCAGTAGCATCGGCACCGCCTCCTCCGGCACCGG
CAAAATTGCCAGCCTTGCCACCGTTAGTTAGCACACCGAGCAACACCTTCACGGGTGGCGTAGATGATGATTTCGATGCGGTAAGCGCCTATATGTGAAT
AACTCATGATTTCTTCGTGTTATAACTTGAATTTTTGTCGACGCAGGAGGAGGAAGCTGAGCGATTAAGAAAGTTGGATGCTGCCTTACAAGCCATGGAA
GCCGAAGATGATACAGGCACACTTCAACAGCTGAAAGCTTCTTTGCAAATGGAACTACAAGAACAGGATAGTTTTGTAAGTGGTGGTGGGTTTGGCAAAG
CGGAAGATGGCGAGGATGATAAGGAAGATGAAGCTGAAACAGACAAGACTGGTAACGATGACGATGAAGATGAGGATGGATATGGAAGCAGCGACTTCGA
GGAGGAAGAAGTTGCCAGGTAATGAACAGGTTGTTGACATAGTATTTGTTGGTGACCCTCACATGAATTTGTGCTATTTACCAGCGAAATCTCCGAGGAG
ATGGAGTCCATGCCGGAGCTATCTGACAAAGAAGACGAAAGCGAAGATGGAATTGCCATTTCTGCAACAGCAGAGCCACCTCATGTGCTTCAGAACGACA
CCTGTGTTGACAGTGAGGATGCTTTGAACAGCTACGACTACATTGAAGAGGTTGAGAAGAGTGGGTGGTAAAACGCCCTAACTACTAGCAGGTTAACATA
TTGAACATGCAGCTACATGATAGCAAAGCGAAATGGTGAATCGCAATTGCAAATTCTCGCTGGTTCTCATCTCCAAGTCTATTCTAGCGTAGTGCTGATC
ACACTACCTTGTTAACAGTTGCTCTACTTGCGCTTTCCTGCTCCGACAAGCTTGTTCAGCAACTTTTGGTCGTCGAAAGCCTCTGGGTGGATGAAATAGT
GGCGATCACGAGCTTGGAATGACACCATGGGATGCATCGCCTGGGTAGGTGGCGACACTTCCGACAATTGGAACGATGTCTTCTCCAGCTGTGCGAACAA
CGTGACCGTCTCGACCGTCACGGTCTGATCATCCTTCGTCTCTGCTCCTGTAGCACTAGGCGACAGCCACATTCGCATCACGTACGGCTTGAACAGGTAG
TGGAAGAGCGACGTCGTGCCCAACCCGAACAACATAATGGTGCCGCACATGGCCCACTGCACGAAAGCAACATCAGTGTGTCAGTTCCAGACTACTCAAT
GCATCGATTTTACATCAATTGTTTTACTGACCTTGCCGACCGTGGACGTGTCTTGCTCGCTCAATACGCAGAGCACAGGCATGCCGATGGACGTGAGGGT
GCAGCTAGTGACGGACACGGCCTTCATGAGACGCACAGCACGCGACATGGGCCCCTGGTACACCTCATTTCCACCCAAATCTGCGTCATATTGTGGCAGC
TTCTCGGTCGCCTCCTCGCGCACCTTTGCGTCCTCATCGGGCTGGGACGAACTGAAGTGGCGAGCAGTGAATGATCCAGCATTACGACGGCTGTTGGAGG
CGAATGAGAACCGTTGAAACACGGTTGTGTTACTAGAACAAACAGCGACGCGGGATGCAGTAGAAAGCGGTCGAAATGGAGTCGGAAGCGCCTCTGCGAG
ACGCACTGCGCGCCGGGACGTGCGCAGCATGAGCATGATCTTGACGCACTGTGGCCCTCCGTCGGTGGGTATACCGGTTGATAACGGTATCGCACTTAAC
ACGGTTAACCCTTCAACCAAAGATTAACCTTTATGGATGTAACGGTATCGCACTTAACACGGCTAACATTTCAACCAAAGATTAACCTTTATGGATGACC
AGGAAAACAGAGTGAAGGCCATCTTAGTCTGACCAGCCATGTAGAAGAGGCTGAGCCACGTGAGCTGATGCGTCCACTACCGGCAGTGGACGTTGGCGCT
GAACCTTGCAGCGACAGCACGGTTCAGTTGTGCGCTGATGTGTAAAACGACAATTGCTACACGGCAGATCGCCAATTGTAGGAGTGTGTGCGGACAGCGT
TCTGGCATCAAAGCTTTCGATTCAAAAGTGTAGACGCCGATGCAACAATGATTTGCAGGTGGAGCCATGTTGCGGACAATGTTGCAGACAATGTTGTGGA
CAAGTTCACGTGTGACAAGTGTCCATGTTTGTCATCTAGTTTGTGTATTGCCACGTACAGTACGATCCCCGTTTAAGTTAGCCTGCGTTTTGATCCAACT
GAGATGGCATACAAATTCCAAAGTTGAAGTGTACTTAATCGGCTCACGCATCGACTTTTTATGCGCGAAATTTATGTGACGTTAGTCGCCATCTGCTGTT
TACTAAAGGCAAAGATTGCAATATCAATCTTTCGTACAGCTCCGCTGCAGAGGCATCGCGCCTTCCTACTCCAACTGAAAGCTGGCATTTTACATTCGAG
TTGGTGGGTCGCTGCATTGAGAGCGCTGCTGCTCTTACTTGATGTGTCGATGAGGTGAGAGGGAACTGTCTCAATTAGCGCCACCGATCCTACCGCCTCC
AGGCCGATCTTGACCTTCGCTTCGATATTTTTTTCGTGTCTACACGGGTAATGTATCAGCAATGACAAAAAGTATGGTCACTTGCCTTCAGGCTGCCGTA
AAAAAGCTCACGACTGCAAATAGTAGCGATCTGAACAATTGATTTGCCTGCTAAGCACTGGAAATCAGCGACATCGCCTTGGTTTCTGGTATCACCACTT
ATCCTTGTATTTCCGTAATGGTGCAGCTTCTTTTTGCCAAAAGGTCATTGAAACCACGAACGCTTTCCCCCGCGCTTTTTGTCCAATTGCCGAAGAGACG
ATACCCAACGCAAGATAAACCATTGAGCCCAGACGTCCACAGTCTCCACCCATAGCCTCACCCTCGCGCAGTGAAAGCCACCCCACTCAAACTCTCGCTC
AGTCGCAGACTCGTCGCGTTGGCGCTTGCTCGCAGGTTGGTCGCTCAAGAGAACTCGACTTCCCACATCATCTCCCACTCGACAGATCAAAGATGCAGCA
GCGACGACAGACTGAGGGTGGAGCACCCCGACGCTCTTTATTGAATCCCTTTGCGACCCAAGCACCACCTCCCTATCATCAGCAACCACAGCCACAGCAA
CAGACAAGCTTCTTGCCATATTCAATCCCATTGGAGCCTTCACTTCGCAACTATAGTCAGCAGACGCAGATGCCTTCAGAACGCTACTGGCAAGGAATGG
ATACGTCGAAACAAGGACGTCACAGAGGCAGCTTGGACTTGGGGGAGTTTGGTGGTATTCTAGACACCGAATCCACTGTAAATGAAGGAGCAACAGCTGC
AGCGGCACCGTCGGAAGCGTCGGATATGAGCATCACCAGCTTTGACGTGACCTCGTTGCATGATGGAACGACGGGGTCAACAGGAGACACGGGTGGGTTC
CACTCGACTGTAGCGACACCGATGCACTTGAGGGCAGTGGAGCCGACACAGCCTCACTTTACGATACGCAGTAAATCCACAGGGGCCTCCTCAGCTTCGA
CGGATCAGGCCCTTGTTGACGCTGCTTACACACAATTCAGTGACTCATCCAACCTGTCCGACCTAACAGCGGAAAAACTCACTAAAGACATAATCGAAAA
GTGTGAATTCCCCGACTGTCCGAACCGGGCACGAGTGTCCCAGTCGAAGAAGAAGTTCTGCAACCGACATGTGATTGTCTCGCCCTGTGGCTTTCCTGGT
TGTCGGGACAAGGCTATGGAGAGAGCTGCAATGTGTGTAAAGCACATGGACCTGGGTAAGGAGGCACTGCAAGCAATCTTGAAGGCTCGCTCACCAAATG
TGCCGGTGTGCAAAATGTCGGGGTGCTTCAAAAATGACCAAGGTCGAGGGTACTGCCGTAGCCACGAAAAATTCTTAATGGCTACTGGACGCCTGCCACC
TCACATCAACAAGCGCCGCCTCAACAGTGCGTACACCATGTGCAGCTATCCTGAGTGCAACAAGCATTCTCAGCGGCATCACTTGTGCCGAACTCACGGA
AATCTTATTATTAAGCAAGCCAAAGAGCTGGCAGATCGACCTGGAACCATGGAAAGCTACGATGAAATATTAGACAGGATGCAGAAAGATATGCGTCGCT
GTACACACGAAAACTGCACGAAAAACTCACAGCGAGATCGATTGTGCACGACTCATTATTACGAGAAGCACCATATGCAAAAGGATAACTTAGCTCGGGT
AAAATCGACTTCAGGTGTTATCAGATCTCAAGAAAAAGTCGATTCGAGAGTGGAGGTCAGTGGTAGGAGCGCTGTCCGGGCTGTTGAGCGGACTCATTGT
GGGAAACCAGGCTGCGGAAATTTGTCGTATTCGGCTGGGCTTTGTGTGGAGCATACTAAAGAAAACCAGAATATGGTCCAAAGTGAAAGACGCTACCGAG
ATCCTTTCTCGGCTGGAGAAAGTGGCCTCTTCTCGGATGACATTGATAGTGAAGCAAAACCGGGGTTGTTGGAAAAGCCTCAAACCAGTGGTATAACTCT
TTCATCTAACGTGACCACGATGACGAATTCTACCCACACGAAGTGCACGAACCCTATGTGTGATCGGAATAGCTTCGGGCGTGACTATTGTGAAGCATGC
CAAAGACTTTTCTCTCCTCTTGTGGTATCGATAAATTCGAGTTCATCTGGATATTCGCCAAGTGTCCCTGGTGTTATTCGGCCTGAGGAAAAGATTTTGC
TGTGTCGCGTGAGCAACTGCGGACAAGATTGTGTCCGTGGAGGACTATGTGCGATGCATCTTCGAGCTTTCAGAACAGGGTCATTGTCTGTGGATAATTT
GAAGCTGGACTCTCAGGCACAACAACAGCTGCGTGAACAGGAGCTGGCTGAAGCGGCAGCAACCGCTGCTACAGCAGCTGAAGAAAAACAAGCAAGTCTT
TCAGCGTCCGGTAAAGCCCGGAAGTATTACTGCAAAATTGAAGGGTGCGACAAACAGGCTCAAAAACGAAATTTGTGCAAGCGTCACTATCGTCTTCAAG
AAGGTGTGCCTGCAGGCAAATCACAACCAGAGGTGTCGACAAGTGGATCACCAAGTAATTTCGCCTCTGGTGCACCGCAAACTGAATTCGCTCAGTCAGC
CACCGGGTGCCAATTTCCAAGTTGCTCACAGTCTGCTTGTGGCGGATCTCTCTTGTGCTTGACGCACTCCAAAGCAACCTTTTGCTGGCAACCAGGATGC
GAAAACCTCGTGGATCACCAGCAGTTCTGCGAGTTCCACGCTTTTCGTCAGCAATGTGCCTACGAAGGTTGTATGTACAGCGCGGCACGGAATAGCAGCG
GCTGCTTGAACCACGCAATGGCGCAAAAATGCCGTCACGAGTTTTGCGATAAATTTGCTGTGGGTTCAGATAGCGAGTGGTGTCGATTGCATCAGATCAG
TTGTCAAGACGCGCCGTGTGCATTGTGTAGGTTGCACGCTCTGACTTCAGTTGGGTGTTTGCCAAGTGAGAACGAAAATATCAATCGCAGTCGGTACAAC
GCTGCGTCGACGTCAAAGGGACTATCTGGAGGTAATTATGGTAGCAACCTGTTCGATCGGAACACGCGGTTGATGTAAGAAGCTAATAGTCGTGGGTAAG
TTTTCATGTATAAGATCGAAAGTAGGAATTTACGATGCCCAGTTTGTGGAGAAAATGCAGACAGTCAAACATGTAGCACAGATTTGCACGAGAGCCTCGA
ATCGGTATACCAGTGAAATATCGGTACCCTCTTCACGTCGATTCTAACGAGCTAGGCTTCAACTCGTCACCAGTCGACCCAGTGTCGTCGTCATCAGCTT
GGCTGGCTAAGCGGCAATGGAGCGCATCTACTCAGCCTTCTTCACGACGGAGCGACGTCGCGAGCCACCGGAGCTCACGGCGGCAGCGCTGGAGTTGCAC
AACGAGACGCAGAAGACGCGCCGACAGCCGCCGCTTTTGCCTCCAAGTGACAGACGACGGCCCAACAAGAACGAAGAGGAATCGACCCAAGAAGCCAAGC
GACATGCGAGTGCTAGACGTCAGGATCTCCACAAGATGACGATGGACTGGACAAGTGTCAAGAAAGATCTGGAGGCGGCGTGTCAAGCAGCAGTAAGAGC
TTTTCTCTTGGCTTACGGAGCTAAAGCCTTCACTGCTGTACTGCTAGCATCGAGAAAATGGAGCAGTCTGGAGTACGGCTATGCAGATGCTGCTAGGTTG
CTGCTGAAAGGAGATACGCTCCGCTTTGGATCGTTTTTCGGGAGTTTAGTGGGGATTTTCAGAGTCACAGAGCTTGCAACTCGAGCTGCTCGAGGCGGAC
AAAGGGATGCAGTCAATTTGGCTATTGCCGGAGCTGTTTCAGGCTCGGCTCTGTTGCTGGACTCACCATCGAGACGCAACACTATTTCATTGTACATTTT
TGTGCGTATGCTGGATGTGGTGTGTCGCCATTTGATGTCGATTGGCGTCTTGCCGACGTGGCAATACTCGTCAGAGTTGCTATTTGCTATGAGCAATGCT
GCTATCATGTATGCATTTGTTGTGGATCCGAGTCTGTTGCCGAAGGTACATTCATTCGATGGATGCGGTTGTTGTAGGAGACATTTTACTGACTTGACTA
CGTTTTTATGAATTATTTCGTCCAGGGGTATTATCAGTGGATTTGTCAAATTGGTGCTGTAAACCACCACGGCTTGGAATATACCGTGCGTCAGCGCATG
CGAGGTCAGCTGGACGCGCATGGAAATCCGTTGCCATTTCGCCTGTGCCAACCTCACTATCACATGTATGTACACCAATCTGTTGCAAGTTAGTGAGATG
GAATTATAATGGTCTGCTTAATTAAATGTTTGACTAGGGAGTCGTGCGTGACGCATGCTATCAAGGAATGGATCAACGGCTTGGGGAGGTCCATGCAAAT
CTACCTGCCTGTGCACTTCCTCCCCGCCATGTTCTTTCGATTCCAACAGCTCCAGGGAGCACCAGTATCCACGACTGCTCGGATCTCCTACGCAGCTCTT
TGCTCTTCTGCGTTCCTCACGTCGTATCAAGTTCGTCATTGAAAATAAATTTCATGGAACTACTCGAGCAACATGCTAACAATTGGTGCTTTGTCAGACG
GTAGTAAAACTTGTCGTTTGCACGACACGCAATGCTTTCCACCGTGACTTTGCCGCGTCATCGCTGGTTGCAGGAGTACGTCAAAATTCTACGCTGTGTA
TCATTTTGTGCATCAATTCTGCTGTACTAACGCAAAAATAATGTGTGCATATCATGTAGCTTGCAACGGGTGGTGCTCTGTTCTTCGAGCATACCAAGCG
CCGCTTTGAGCTCATGTTATACTGCTTCCCACGCGCGCTTGACATCGTGTGGCAACTTTTGAAACGGCGTGGCCTCGTACGCTATGTGAAGCATAGCGAG
GTAGTGCTCTTCTGCCTCTCCATGTCGCTCATCATGTCAAGTCCTGCGCGTTATTTCAAGCCGACATACCTCCGAATCTTGCGGTTCATTTTTGGCGGCG
ACATTATTTGAAGATCCCGGGTCAGTTGGATAAACAGATATCTATCCAAACCTGCAAGTACAAAGAACAAGTACATGCCATCTCAACACCAAATCGTTTC
GTGTTTTATTCACTCATCGTTTCTTATGAACATGACTTCAGTATTCCAAGGCGTAGCTCCTATTCCAAGTCATTGAACACAAACAAATCAAGCATTTGCT
TGGCTTCTTCGGGCTCATCCATAGGCACGAGGTGGCCTGCACCCTTTACGGTCACGTACGTGATCCCCTTGAACGTCTCCACAAATCCGCCCGTTTGCTT
CGTATTACCTTTTGTGTAAGTCCATGCCGACCGTGATGTCAAGCGGGGTAGACCTAGCGACTCTACCGCCCAAAGCCCACCCAAAGCATTACAGACCATG
TCAGCATCACCGTGGTAAATAACGCCCTTCACCCCACCCTCAAGTAATTGGCGCCACAAGGGCGTCACTTCAGCATTCAGTGTAGGAGTGTACTTCAACA
TTTGGGGGTGCTGCAACATCGGGTGATCGACACCTAGAATCGCGCTAAGCGTATCCATGGTCGCCGTAGTGAGTGCGTCAGCGCTCCAATGAGCTAGTGT
CGGGTTCGCATGCATTGAGTCACGGACTTCGACCAGGTTAAAGTATGATTCGAGGTGCTTATTATCCAGGCACAAGTCCATCGTGTTGCCAATAGGGTGT
GGCATCTTCCCGGGCGTCGACGGTGTCAAGATCTCCTTCACAAGACGCTGGATATCCTCTTTGGGTGATCCAGCGCACGAGCCATAGACGTCGTACATGT
TGATGCGATCATATACCAACGTCGAGAACATATCCATCGTGGCTGAGGTGCACTCTGGGCTAGCATTGCTGATACCGGGCGCACCGAGAGGGCTCTTTTC
GAACTCGCGGAACTCGGAACAGCTACCTCGGAACTTCTGGTACATTTCCGTGCTCAAAAGACCATGGTAATACGCAAACATGGCAGTGGAAAGTCCCATG
TACTCGTTGACGCCATTACCCACCACGAATTTCTTCAAGTTAATGTGCTGTGACTGATCTGAAGTCGCCGCGTTTCCATTGAGAATAGCAAGTGCCGTCG
TCGGCACATAAATCCCGCCGTAGCTTTCTCCAGAGACGACAAAGTTGTTCTCTCTTAGCCACGGGAATTTCCCAAAGAACTTCTGCAGTGCGTCGTACAG
ATCTTGAGCCTGAGAGAGATCGTCTGCCTCGTACACTCCACTGGAGTTGTAGCTAAAACCGACACCCACGGGCGACTCGATGCACAGTAGATTGGCTTGT
TGGTTCCAAGCAAATTTGTTCACTCTCAGTGTTTTCCCATCCCCGTTCACCAATAGTGGTCCATTCTCTGAGAAGCAGCCCGATAAAGAGCTGGCACCCG
GTCCTCCATTTAGCCAAAGTAGCACGGGGTCCGTTTGAGGCGCGGGGCTCTGAGACTCAGCGAGGAAGTAGAAGGCGTGGCCTCCATTGTTCAATGGCAA
ATAACCCGAGAAGAGTCGTGATGTGTAGTCACTGGGTTTACCCGCAAGTGTCAGAATCTCATCAGTAGAACCAGGAAAGGATTCAATGGGCAGCTCTGGA
GACTCCGCATCGGCTGAGTCCTCCATCACCGTAGGCTGGGCTCTGTGTTCGCCTGTGCGAATGAGGTTCTCCGTCTGTAGCGAGCGCTGCAGCGTCACCA
TGAGGTCTCCCACAGCTAGAAACAAGAGGCACGCGACGCCATAACGGATGAAGCGCCGAGCTGTGGACGAGAGCAGTCGGCGCGAGCGACCTGCAGCCGG
CAGCGTCTGGCGGGAGCGCAGCCCGCGCGTGAGCGGCATCGTCTCGTTCAGCGGATCGGAGCGCTGGTACATGACACGAATCAGGAATGAGCTCGAGCTT
CTAGGGCCAGGATACGAGTGATGCTTGTGATAGGACGAGCGCTGGAGCTGATTACGTCGAAGTTCAGTTAGCCCTTTTCTGCAGATTAGTCAGATACAAT
AGTATCGGGGCTGTTACCGGTTTCGACGCAAGGGCTAGCTAGATACATTGTGGACTCAGAAGTCCTGGATGCAAGCTGCAGCGCTCTTTCCAATGCTTTG
CATTGTCCAGTTTATGCAAATCTCTGCAGATCGTGTACATACATTCCGCCGCTGGAGTCGGCATGTATGCTGATCAAGCAACTTTACATGTATTGTGTAA
TGAACCAACACTAGCAATTTGATTTGATTACGAGTAGTTGACTATAGGTAGATTTCTCCCAGGCATGCCTCATACCGTTGAATCAGAAAACGCATCCGAA
GCAACATACCAAGAAGATCACAAACGCGACCACTATCTCGTCGACTGTTTATCCAGGCGGGAGGCGGGAGACATCGACCTCTTCGTCGTCAGCCTCATCC
AGAAGCGTGCGCGTGGCGCCCTCGAACGTCGACAGGTCACCTAGGTTGTCGGTCACGCTGGTGCTGCGAGCCATGGCGATGACACCACTACGGTGGATTT
CCGTGATTCCTAGCGGCTTCAGCAGATCCAAGAAGGCCTCAATGCGGCCAGGGGTGCCAGCCAGCTGCACCATGACCTGGTGTGGTCGCACATCAATAAC
CTTGGCGTCAAAGAGGTTAGCCAGCTCCACCACCTCAGCACGAGATCCAGCCTCTGCACATAGCATCACCAGCAAGTGTCAGTATTATGTCCACATTTCC
GATGCTGCAATTCGTACGTACCGGCCGTGGACACCTTCGCAAGCATCAAGTCTCGCTCAACGTAGTTCTTCTGGGCGTTCTTGCCACTGCTGAGGATGTT
GACCACAGCCACGTACACGACGTCCTCCAGTTGCTTCTTCATCTGCAAAGACCCAACAATTGTTAACTTTCTTCACGTCTTCCATCTCATCAACTGCCCG
TACATTGACAACACTCTGCGCAGTGCCATTGACGACCACCGTCATGCGGGAGAGCTCCTCCACCTCGGTACGTCCCACCACGAGACTGTCAATATTGTAG
CCTGCAAACCCACACTCATCAGCACTTTCACACTATCATTTCATCCTTGTACATCCACATGTACCTCGAGCAGCGAAGAGGTTGGCGATCTCCGCCAAAC
AACCAGGTTGATTCACCACCAACGCAGCGATCACATGACGTTGACTCTGTTCCGCCACACTAAATGCACGAGAAAAGTGCTTGGGGCCACACGGTGCAAT
CGCAGACCGCGAGGCGCAACGTGCCAAGGGCAGCAAAGACCTCCGCAGCATCTTGTCGAATGTCGAATGTGGCGTCTGAAGCTCGTGGTCCTAAGTTCGA
CCTCGGGTTTTCGAATCTGTCATGGCTGCGCAAACATCTCCACTTCCACTAAGTACGAATACGACGAGTGACAGGCGCTAGAAAATGAACGTGGATGTGT
GCGCTTGGATGCTGCGCTGCTGGGCGTGCAGCGTTGCAACGGGGCTCGTTCTCGCTGCTGTTGCATCGCCGACTGCTCATGAGCTCGTGTATGATCCGAA
TACCGCCGTTTTCGCGGATCTTCAGGGACCTGTAAAGCCCTCAGTCGCTGTAAATGGAGTCGACATTGATGCGATATTGGCAAATATGACGATCCGTCAG
AAAGCGGCGCAAATGACGCAGATGGATATTTATTCCATGATGAACGGAGATGAAAGGGACCCGAAAAAGGCTCTGAAGAGAGATGTGGTGGCTCGATACG
CTCGTGAGGGAGTGGGTTCTATCCTTAATAGTCCATTTGCAGGGGGTCCAGTGGGCGGACGCACGGGGTGGAACGCCAACGAATGGCGAGATGTGATAAG
CCAAATCCATCAGATCTACAAAGAGGAGGGAGCTGCAGTACCCATGCTCTATGGGGTGGACACTATTCATGGTGCCACGTACGTGCAAGGCGCTACATTA
TTTGGCCAACCCATTAATGCTGCTGCCTCGTTCAACACTGAGTTGGTGTACCGCATGGGTGCTGTTGCTGCAAAAGATACTTTGAGTGCGGGTATCCCGT
GGATCTTTAGTCCCGTGCTGGGTATTGCAGTTCAGCCAAAGTGGTCAAGGGTCTATGAGACGTTCGGAGAAGATCCTTTGCTGTCGTCTGTCATGGGAGC
AGCACTGATTAAAGGGCTTCAGAGTTCGGGCAAAGTGGCGGCGTGTATGAAGCACTTTATAGGATACTCGAACGTACGTGAAGGGCTTGACCGTGCTGAC
AATGCCATTACGGACTGGGAACTTGTCAACTATTATGCACCGTCGTTCCTTGCCGCCGTTCGTGCTGGTGTGCGTACAGCAATGGAGAGCTACGTATCAG
TGAACGGTGTCCCTGTGATTGCGAGTAAGAAATTACTGGTCGATCTCTTACGGCACGACATGAATTTCACGGGTCTGCTGGTCTCGGACTATAGTGAAGT
GGATCGGATGTTTTACGAGCACCATTTAGTACCCAGTGTGGCTGATGCTGTTCGCGTTACCCTGCAGGAGACGTCTCTTGATATGAATATGTCACCGGAC
CTGCAAGCTTTTGGTGATACGATCGAGTCGTTGGTCACAGATGGTCTCATTTCAAAAAGCCGCATTGATGAATCTGTGCGACGGATTTTAGAGACCAAAA
GAGAACTTGGGCTACTTGACGCGAATTATTACGATGAATTCACACAGAATGAGGCGTCCAATATTGGCAACGTCGGGAGTGCTGCTGACCAGGAAGACGC
ATTAAAACTAGCCCAAGAGTCTGTTATTTTACTCGAGAACCGCAACAGTGCTCTCCCCATTGATCTGAAGAAGACAACAAACGTGTTTGTGACTGGCCCT
GTGTCAGACAACAAGGGGTTTCAATGTGGAGGTTGGTCCGTGTTCTGGCAAGGTTCAAGCGACTCGACGCTCTTTCCAAATGGCGCCACATTTAAGGATG
CTGTACAGGCGAAGGCGGCTTTGTCGAGTGGGCAAATGAAGGTGGAACATCTTGAGGTGGTTGATATTGACGGCAAGATTAAACCCCGGGATTTTCAGCG
TGGTCTACAACTTGCTGCCAAGAGTGAGTACACTCTGGTTGTGTTAGGTGAGCCAAACTACGCGGAGAAGACAGGAGACTTGCTTGGTAATATGGCTTTA
CCTGCTGGGCAATTATGGTACCTTGAAGAGCTGACAAAGCTTAACTCAACCAAGGTGGTTGTCATACTGGTCTCAGGTCGCCCTCGTTTGCTTGAGGGGG
CCCATAATCATGCCGACGCTGTCATTTTGAGCATGCTACCGTGCGAGCAGGGTGGTAAAGCGCTGGCAGACGTGATTTTTGGCGATGTGAACCCGTCAGC
CCGGCTGCCGATTACCTATCCAGCTCGTGGAACGCAGCTTTTGCCGTATTTCCACCGCGTTAACACGCGATGTCAGCCGTACGACGAGTGCCCAGTGCAA
TGGCAATTTGGCCACGGGCTCAGCTACACAAAATTTGAATATTCAGCACTACGACTCAATGCCACTCAGGTGCACGCTACAACTGGAGCACTAGAGGTCA
TCGTCACCGTGAAGAACAGCGACGCTCGCCCGGGTAAAGAAGTCGTGCTTCTGTTTGTATCTCAAAAATTTCGGCGTGCGTCCGTCCCCGAAACCAAGTT
GCTCAAGGCGTTCAAGAAGCTGGACGAGTTGGCACCAGGAGCCAGTCAAGATGTCAAATTTGTGCTCACATCTGAACATTGGAGCTACTACGAGCCTCAT
GTTGTGGGCCACGGTTTTCAGAGGCAAACTG