Transcript Name :
Phyli_Pl_113119
Orientation:
(-)
Number of Exons:
2
Description :
ferric reductase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Cytochrome b245, heavy chain0.000013PR00466
Cytochrome b245, heavy chain0.000013PR00466
Profile scan predictionP-Valprediction_id
EF-hand domain5.28PS50222
EF-hand domain9.436PS50222
Ferredoxin reductase-type FAD-binding domain10.802PS51384
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-361
362-384
385-398
399-421
422-440
441-463
464-504
505-527
528-533
534-551
552-555
556-578
579-880
*** None ***
PositionContextScore
37PNSRNKR|PA0.798
49NSMRGKR|PT0.645
*** None ***
GO
Biological ProcessGO IDPrediction Method
oxidoreductase activityGO:0016491IEA
calcium ion bindingGO:0005509IEA
membraneGO:0016020IEA
*** None ***
*** None ***
Sequence
        2701 bases(100 bases per row)
TGCAACAAACTAGTCACGCGCCGTCAGAGGAGCTTAAGATCACCCCTGGCCAGAACACTCAACCGTTTGTTGATATCTCCACGCCGTCGCCCAACTCCCG
CAATAAGAGGCCAGCCAGCAGGAAAAACAGCATGAGGGGAAAACGTCCTACAGCCCCGCAGGCACCTCCCCCACCGCCTCCTATGGCGAACCACCCCGCC
ATGATGACCTCGTTCCACAGCACGGCCAAGTCGAACTTCATGGATAGTAGTCAGTTCATCAATATGAATGCCACCAGCACACATATCATTGGACGAGGCC
CGCCCAAGATGAGTGCCAATTGCAAGAGTAGCCGCGGCAATCACCGTCGTCGCCCTAACGTTCAGGCCATGCTGGGTGCGTCCATGGTGCGCCAAAGTCT
AGCTCGAGCGTCCAATTTATCGTCATTCGCTGGTTCCAGGTACGGCCCGCAACCCGGCAGCGATGTCATGTCGGTCCCAGTCCTTGGTGACTGCAACTTT
GAGCAGAAATACAGCGTGGCCATGAGCATGGATGAGCACGTTGCCCACAGCAATGACCCAGCGTACACCCCTATGGAGAAGCTGCACGCACTCCGCGACG
TTATGAGCAGTATCACCAGCAAGGGTGGCTACATTGAGCGCGAGACGTTTTCACAGGCTTTCGAAGTAAACGGCAAGGAATTCGACGGCTACGCTACCAA
CAACGGTGAAATTGATGGTAACGCCATTCTAATTGACGCTGTTATGGACCTCGAAGTGGGCGCAGAGGAGAAATTGCGTTTTATCTTCGAGACACTGGAT
CCGGACAACACAGGATATGTGATTGAAGACCAGATCGTCCAGCTTCTGGAATCGAACTTCTCAGCGGCTCGCATTGACGTGGTTGGCACGGACTTCAAAA
CGGTGGCTAAACTCATGTTCCGCAAAGCCCAGGTAAAGGAAGAGTCGATGACGTACGAACAGTTCAAGACGGTGTTCGCCCCTTACATCAACGACTCGTA
CAACCTTCGCAAATCGGAACCGAAGTACACGGCGCCTATCCGTCCGAAGAGTAAGTTTGGCGCTTGGTACAGCGCCAACAAACTCCGCATTTGGTGGCTT
CTGGTGTACGCAATCCTCAATAACGTCGCATTCTGGGTCAAATGGTTTGCCTACGATGTCGACCCCGCCATTGGTTGGGGCCTTCGTATTGCCCGTGCTA
ACGCCCAAGTTGCTATGGTCAACTGTGTGTTCGTATTGTTGCCCATGTGCCGTTCAATCACACAGGTGATGAAGCGCAGCAAGTTCTTATGGCGCTACAT
CCCGTTCGATGACAGCATCGCCTTCCATAAAATTTCGGGAAGCGTATTGCTTATTGCTGGCCTTATTCATACGGTTGCCCACATCTTCAACGAGGTCTAC
CTGTACCTGATCGCCACTCCAGACGAGATCAAGCGATCCATTTTCGTCCAGCGTCACGTGTCTTCGTTTGTTAACGGTGAACGACCTCCGTTCACCACTA
TGCTTCAGTCGCTTCCAGTGTGGACAGGTGTAATCCTGTTGGTAATCACCTGCATTTCGTTCCCACTCGCTGCAATCCCCAAGTTCCGCCAGGGCAAGTT
CAACCTCTTCTGGTACTCGCACATGCTGTTTGGAATCTTCCTGTTCGTGTTGTCATTCCACGGTGCTGCTTCATGGCTCGCTCGCTGCTCATCCTACATC
TGGATCACCCCTCCATTTTTGATTTATCTGATCGAGCGTCGCTTTCGCTACGCTAAGATGTTTGCTGCACCTGTCCGCATCATGGAGGCCATGGAGCTGG
ACGGCACCGTCGCTTTGTTTATGGAGAAGCCTCGTCGTTTTGTGTACCGACCCGGCATGTACATGTTTGTTAACTGTCCTCTGATCTCTTCTCATGAGTG
GCATCCATTCACGATCTCGTCGGCTCCCGGTGACAATTACATCAGTGTTCACATTCGTGTGTGCGGTGACTGGACGCAAGCCTTGGGTCGCGTCATCGCG
GACTGCCACGAGCGCAAGGTGCTGTATCCTGACATTTACCTGGACGGCCCAGTGGGTGCTCCTACTCAGGACTACCACCGATACAAGACTCTGACATTTA
CCTGGACGGCCCAGTGGGCGCTCCGACCCAGGACTACCACCGATACAAGACGGTCATTTGTGTTGGCGGTGGCATTGGTGTCACCCCGTTCGCCTCGATC
CTCAAGGACGTGGTGCACTTGTGGGAGGACAACCGCTGCACGAACTGCAACCATGTTCGTCACCCTGGGTCGTTTAAGATCCAAAAACTCTATTTCCACT
GGGTAACCCGTGGACAGGAGTCGCTGAGTTGGTTTGAAGAGACCATGAACCAAATCGCGGAAATGGACCGCGACAACGTGATCGAGACACACCAGTATTT
GAGTACGTTGAAGGGCAGCGAGAACACCTCGCAGCTCAAGATGTTCCAGGAGTTCGTGCACGAGCAGACTGGCCAGGATTTCGTGTCTGGTCTCAACACG
AAGCAGCTAACGCACTTCGGTCGCCCGGACTGGGACAAGGTCTTTTCCGAGGCCAAGGCCAATCACCCTGGTGAAGAAGTTGGTGTGTTCTATTGCGGCC
CTCACGCACTTGAGGAGATCCTGGACACTACGTGCAAGCGGTACTCGTCTTCAGACCCCAACGGAACGATTTTTGACTTTCACTCGGAAAAATTCTCATA
G