Transcript Name :
Phyli_Pl_113146
Orientation:
(-)
Number of Exons:
2
Description :
hypothetical protein PHYSODRAFT_248380
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Filamin/ABP280 repeat-like19.37PS50194
HmmSmart predictionP-Valprediction_id
Kelch repeat type 12.3SM00612
Kelch repeat type 110SM00612
Kelch repeat type 10.077SM00612
Filamin/ABP280 repeat0.00000000001SM00557
AAA+ ATPase domain0.6SM00382
AAA+ ATPase domain0.83SM00382
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Filamin/ABP280 repeat-likeIPR017868
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
nucleotide bindingGO:0000166IEA
*** None ***
*** None ***
Sequence
        12430 bases(100 bases per row)
TGTTCGGCGGTTGTGATCACAAATCACCTCCAGGGCCTACCAACGAACTATACAGACTCGACGTCACAAATGGTACGGTGGTCATGATGGGAAACAGCAA
ACCTATTTTATCGTATTACTCTAAATTAACAGTAATTCTATCTTGCTGTCAGGCTACATGTGGTCCAAAGTAGTTAGCTCACAGAGCGATGACGAAGTAC
CAGCACCGCGGTGGAGGCATTCAGCGATTCTATTTGAGAAACATATCATCATATTCGGAGGCTTCGCGGCTGAAAAGCGTATGAACGACCTGTGGATTTT
CAACACCGAATTAAAGGTGTGGGAACAGAAGTATGCCCAGAGCTTCTGGGAAGGGCTACCGCAATGCCGCGGAGCACATAGCGCTACACTTATTGGAGAT
AAGATGTACGTGTTTGGTGGTTACGGCGGAAATGGCTTCGGTCGTACCGACTTCAATGATTTACATGCGTTGGACCTGCACTCATTTAAGTGGCAAGAAA
TTCAAACTGAAGGGGAAAAGCCGGAGGCACGCTCTGGGCATCAAGCATGTTTGGTCAAAGAACAATTGCTTGTTATCGGGGGCTGGAACAGCTTCAAACA
ATTTCAAGACATTTTTGTTTTTGATCTACCAACGAAGACCTGGAGCTTGTTGGGTACTCCTCTTCATTCACCTATCTGGAATCACACGTGCGTAAGTGTA
GCAGCTGTACCTCACTGGAAGGTGTTCTTGTTTGGTGGCAACAGTGGAGATTTAGCTGAGTCAGGGACGGCACAAGGTGCTTACTTGAACAGCACAGCTG
TGTTGGACACAGGCACCATGGTGTGGCTTAATCCGCCAGTAAAAGGAGAACTTCCAAAGGCGCGCGCTGATACTGCCATGGTGTTTGATGCAAACACTAA
TCACTTGATCTTCTTTGGTGGTTGGGCAAATCGCTGGTACAACGACTTGCATGTCCTCAATGCAAGTGAAATCGTTGGGCCACCATACTCCATTTCGTCG
ATCGAACCGAAGCAAGGACCGATAACAGGAAATGCAAAGGTTAAAATCACCGGCTTCAACTTTACAGGCCAAAACGCAACTCTGCGTTTCGCTGTTGCCA
AAGGCTCAGTCGACGTGACGGGAGCTGTGCTCAGCCCTAGCGTTCTGCAAGCAACAGCCCCCAGCTTTGAGAAATTTGGTCCTTTGACTTCCGAGGTTCG
AGTGTCATTATCTGGAGGCATGTACACAAATGTCGCCACATCCTTCCGATTCCATTCCGTTACTGCTGCTCCGAAGTCACTAGCGTTTGGTCCGTGTCTA
ATTGCTGCACTCAGTGACAATTGCTTGGCTGAGCTACCAACAACTTTCATCATTCAGGCTCGAGACAAAGATGACAATCCTCGCGACTGCGGAGGAGATG
AATTTACGATTTCTCTGAAAAATTGTGATGATCCTCAGGCCGAAGTGGAGCAAGTTGCATCTATCCTCGATAAAAACGATGGCACGTATGTGGTCACGTT
TACACCACCCCAACCTGGCAAATACGAAGTCTCAGTTGACTTCAACGGCACGTTTAGTGGTATCGCGGGCCCCATTCGTGGGTCACCGTTCACTGCAGTG
TTCCAACCCGTAACAGATGAGAATAAAACGAAGTGTCTGCCGCCACTTACCACACAGAAAGACTTTGACTCACCAGAGTTGATTCGTCGTGTAATGGCAA
CTATGAACAAACGCAACGGAGAGTTTCGCCGTATTCTTGTTGATCTGCGGAAAGATATCCCGAACAATGACACTGAGGGTCTTGAAACTCTGCGAAAGGT
TAAAGAAATTATTCGCAAGCTTGAGACAGAGAAGACGACAAACCACTTGATCCTGGATCAAGTACGACAGCTTTTCTTCAACATCAAGAAGAATGGCGGT
CATGTCGACAAAGAGCTGGTAGAAATCGAGAGCATGGAAAAGCTTTTTGTGGATGTTGAAAAACAAATTCCGGTCACTGAGAAGCGTACTCAGGAGCCTA
CGCGAATATTCAGTGAAAAGACCGAGGAGAAGATCATCGCGTATGAGAAGATGATCGCACAAAAGATGGAAAGTCTGAAGACTTTAGATTTCTGGTCGTC
GAAGCTGGAACCTGACAAAGGTTTGGAGAAAATTGATAACTATCTCATGGATTGGAACATGGAAATGAAAAAGTGTGAGGAGAATACGAAGCTGTGCTCC
ATCTTCGGGTTCCCACAGCTGATGAACGAATCACTTCGCATGATGGGTCTTATGCGCACAGATGCAGATGCGATGAAAACTGTGTGGGCAATTATTAAGC
GTGCCAAAGCCTTTTTCAAGGCAACTCAAGACATTTTGTTCAAAGAAGTGGATGTAAACGCGCTGCAGGTTGAAGTGCAGTCCGCTTTGAAGGAGTTGAA
GAAGATTCCCAAAGGGATTCAGTGGAGTGATGCGTACACTTCGATCTTAAAGGAGTGTCAGGCGTTTGATAAGACGCATCCTCTCATTCGTTGTGTATCG
TCAAGCTACATGCGCCCAAGGCACTGGAAGCGTATTATGGCTCACACAGGAGAGTTTCCAACGCCGGATGAAGATCCTGAGCAACGACTCTCTTTGATTT
TAAGCAAGAACCTCTTCAATTTCAGCTCGGACGTCAATGAAATTTGCTACGAAGCAGAGAAAGAACAGGAGCTAGAGCTTCGGTTGATTGAGCTCGAGGG
ACTATGGGCCGAGGTAAATTGGGAGATGACTCCGTACAACCCAGGCGCTGCTGAAGAAGATATCGTACCTCTCCTCAAGGTGTCAGAAGAGAACTTTGAG
CTCCTTGAAACACATCAAATTGATGTGCAAGGTATGAGTGCTTCACCATACCAGTCAGAGTTTGAACCCCGTGTTGCAAAACTCCAGATCGGTCTTTCGT
CGATTAATGAAGTTGTACTTTTGCTGGGAGACATTCAGCGATCTTGGAGCTACTTGGAACCACTGTTTATTCAGTCAGAGGAAGTGAAGAAACAGTTGCC
CGAGTTAACATCCGACTTCGAAGACATCGACAGGGAGGTTCGTCAAATTCTGAAGACGGCTTGGAAGACTCTTAACGTGCAGGAAGCATGCACAGAAGCA
GGTCTTATCAAACGACTAGAGGTTATTGTGGAAAAACTGGAGCTGTGCAAGCATCGTCTGAAAGAGTTCCTCGACGGGCGTCGCCGCCAGTTTCCCCGTT
TCTATTTCATGTCTGAAGCAGATTTGCTTGATATTTTGTCGAATGGATCTCACCCCGATCGGATTATGCCTCACTGCTCCAAAATCTACCTGGCAACCAA
GACACTCACCCTCGTGGACCGCGGGGCTGGAGAACGACCAGTCGCTACGTCTTTTGTGGCTGGTGTTGGTCACGAAGTTGTTGATTTCTTTGAACCCCCT
GTTCTAGAGGGAGAAGCTGAGATTTATCTGGAGACTATAATGCGTGCGATGAGGTTGACGTTGTTCAAGCACATTGAGCGCTCACTTGTTGCTTACACTG
AAATGCCTCGTGTTGAATGGATCAACTTCAAAGATGACACGAACAAACCCATGGATGCAGCTCAGATCATCCTTCTTGCAGCAGGAGTTCACTATGTTCA
AGAAGTTGAGCGCGCTTTCCGTGCAATTCAGGGTGGAGATAAGGACGCCTTAAAAAACTACAACAAAATGCAAGAGAAGCAACTAGAGGATTTGATCAAG
CTTACACAAAGCAATATTTCGTATGCAGAGCGACAACGTGTAATGGTGCTTATTACGATGGATGCTCATGGTCGAGATATCGTGGCAAACATGATTCGTG
CTGGAGTGGAGGAGGCGACACATTTCCAATGGCAGTCTCAACTAAAACACTACTTTTCACCAGCAGCAGGCAGTTTCTTGAAGCGTGACAGCACCTTCCG
AGGAGCAAATAACGCGCGAGCTCAGATTCTTATCTGTGATGCTGGCATTCCTTACGACTACGAGTACCTTGGAAATGGACCCCGACTTGTGATTACCCCA
CTAACGGATCGAATCTACGTGACAGCAACTCAGGCGCTGAACTTGCAGATGGGATGTGCTCCTGCTGGACCCGCTGGTACAGGCAAAACTGAGACAACCA
AGGATTTGGCTAATGCTCTGGGAAAAGTGTGCTATGTGTTCAATTGCTCACCTGAAATGGACTTTAAAAGTTTGGGGAACATTTTCAAAGGCCTTGCGTC
GTCTGGTTCGTGGGGATGCTTTGATGAGTTCAATCGACTGGTGCCTGAGGTGTTATCGGTGTGTTCTGTTCAGTTTAAAGCAGTGTGTGATGCTTGTAAA
GCTGATGATGAGAGGTTTATCCTGGAGAATGACGAGGTGATGCTAGACCCGACCGTCGGCGCATTCATTACTATGAATCCTGGCTACCTAGGACGATCTG
AACTACCTGAAGGTCTGAAGGCATTGTTCCGACCTATGACTGTCATGGTGCCCGACCTGGTGCTAATTTGCGAGAATATGCTAATGGCAGAAGGATTTAC
CCAGGCGAAGATTTTGGCGTCGAAGTTTTACGGCTTGTATTCTTTGCTTGGGCAGCTTCTATCTAAGCAGCTTCACTACGATTGGGGACTTCGAGCTGTA
AAGAGTGTGTTGTGTGTCGCTGGTGCATTCAAACGTGCCGAGCCTGATATTCCTGAGACCGATTTGCTCATGCGTGCATTGCGAGACTTTAACATCCCAA
AAATTGTTGCAGAGGATATGGTGGTGTTTTTTGGACTTCTTGGTGATCTGTTCCCGCGTGATAGTCCGAATGTTGACGTCCGAAATGATCCCCCTCGGAA
GCGTGACATGGAGCTTGAATCCATGGTGCAAGGAGCTTCAGAAGCTATTGGAAACACACCTCGTCCAGAATTCATGTTGAAGGTTGTACAATTGTCCGAA
CTGCTTGCAATTCGACACTGCGTCTTCGTGATGGGGCCTCCTGCTTCTGGTAAAACGGAGACCTGGAAGACACTGAGGAAGGCTCGAGAAATCATGGGCA
CACCTATGGAAGTACAAGACTTGAATCCGAAGTCGGTGAGTACGAACGAGCTATACGGATATATTGTGTTGAAGACACGTGAATGGAAGGATGGCTTGCT
TTCGCGCATCATGCGTGACCTGGGATCAAGGCGCCGTGATAACGGTGATGAAGATAATAATCCCAAGTGGATTATTCTAGACGGAGATCTGGATGCAAAC
TGGATCGAGTCCATGAACTCTGTCATGGATGATAATAGAATGCTCACGTTGGCCTCAAATGAGCGGATTCCACTGAAAGTGCACATGCGTATGATTTTTG
AAATCCGTGATCTGGTGTACGCCACGCCGGCCACCGTCTCTCGTGCTGGTATTCTGTACATTTCAACGTCGGAGGGTTATCAGTGGCGCTGTTTGATTGA
CAGTTGGCTTGACCGCCACTGTCACGAACCTGTTGATCACCGTTTGAGAAATATGATGTTCACTCCGGACACACGTGCCAAATTTCAGGGGCTTTTTGAT
CAATATGTCGAGACGACGCTCAGATTCTTCCGCAAGAAACTTGTACCCGTTGTCCCTGTGGAGGAGACGACTCTGGTGACAAATTTATTAAACATGATTG
ACTGCTTGTTGACTCCACAAGTGCTGGAAGACTACACTGTGATGCAGAACACATTTGTATTCTGTTGTGTGTGGTCTTTTGGTTCCATTCTTACGATGAG
TGACGATGGTACGGACTACTCAGCTGAGTTTAGCAACTGGTGGAAGAATCAGTGGAAGGATGTGAAGCTAGTGGCTTCTGCTAGCAACACGGTGTTTGAT
TTTTGGCTTGACCCTGAGACTTCAAAGTTCAATTCATGGTCGAAGAGTCCGTACTTTTACACGGAGACGTATGTGTCCCCGAGTCCGATCAACCAGATTA
CTGTGCCTACCACTGAAACAGCATCAATTGCATTCTGGCTTGAAAATCTAATTTCGAAGAGTGTACCGGTGATGGTGTGTGGACCTGCAGGTACGGGTAA
GACGCAGAACATCATGGGTATGTTAAAAAAGCTCAGTAAGGACGAAGCTACGGCTGCATTCCGCTACTGTACTATCAATTTCAACTTTTACACCACAAGT
GCCATCTTACAGCAGACCATGTTTGGCCAACTGGAGCGTAAGACCGGTATAAATCTAGGTCCACCTGGTAAAGCAAGACTTATCTACTTCATGGATGATC
TGAACCTTCCCGAGGTGGATCCATACAATACCCAGAGTGCTATCTCTTTATTGCGACAGGTGATGGAGTACAAACATTGGTTCGACCGCGTGAAACTTCA
GCCTCAGAATATTCTGAATACGCAGGTTGTCTCCGGTATGAACCCCACGGCAGGTTCATTCCTTGTTGACCCTCGACTTCAACGCCATTTCTGTACATTT
GCGATGGGTATGCCTGAAGCGCCAAGCTTGGTCACAATTTACGAGACGTTTCTGGGTGGACATCTATCGGGATTCGCAGATGAACTAAGCAACTCGCAGT
TCTCTAATGCACTTATTAAGGCTGCGCTAAGTCTTCATGCAAGTGTTGTTAGCACGTTCCGTAAGACTGCAGCCAATTTCCACTACGAGTTCAACGTTCG
CCACTTGTCCAATGTCTTTCAGGGGCTCATCGCGTCGAAAAAGGATCGTTTCAATAGCCAGGAGAAGTTCGTGCTGTTGTGGTTACACGAGAGTGAGCGC
GTGTACGGTGACCGGCTTGTGTGTAAGGCTGACATCGAGAAGTACAATCAACTCGTGCAGATGCAAGTGAAAAAGTCGTTTGCATCATGTAATACGAGTC
GATACTATGCTGCAGAGAACTCGTGGCCTCTAATTTTCTGCCACTTTACGAAAGATGGCGATAACGAGTACGATCAGATTATGGGAACGAACCTGGATGA
CCTCAAAATGAATCTGCAAGTCCAGCTTCGTGACTACAACAATAACGAAAACAATACTGCTATGCAGTTGGATTTGTTTGACGATGCTGTGAAGCACGTG
GCTCGTATTGTCCGTATCCTGCGTAATGAAAGTGGTCATGCCTTACTGGTAGGTGTAGGAGGAAGTGGTAAGCGATCACTAGCGCGATTGGCTTCACACA
TTTGCGGCTACACCGTTCGCCAGATTACTATCAGTTCCAAGTACGGCGAAAATGAATTCAAGGAAGACTTGCGCAAGATGCACATGGCAGTTGTGGAAAT
GTTGTCTCGCAACGAAGAAGACGGAGGTGTTGTGTTCATGCTCACGGATTCGCAGATTACTAATGAGAAGTTCCTCATCTACTTAAACGATCTGCTGGCC
TCCGGTGAAATTCCTGATCTATTCGCGATGGAAGATATGGACAATATCGCCAATTTACTATCTCCGGTAGCTGGAACAAAGGATCGAAAGGAAGTCATCA
AATTCTTCCAAGCGGAAATTCGTAAGCGTCTTCACTTGTGTCTATGCTTTTCACCTGTCGGTGATGACTTTCGCAATCGTGCGCGCAAGTTCCCTGCGCT
TGTGAATTGTACGGTCATTGACTGGTTCCAGCCATGGCCTAAGGAAGCTCTGCTCTCTGTCGGTCGTGAAAAGCTTAAAGAAATCGGTGACTTGCTGGGA
TCTGATGAGTCGCGTGCAGGTATTGAGAAGTTTATGCCGTTTTCATTCCAGTCGGTGAATATCTGCGCAGAGCGGTTCTTTCAGGTTGAACGACGCCACG
TGTACACGACGCCCAAGTCGTATTTGGAGCTGCTTCAACTGTACAAGAAGATTCTGCGCAAGAAAGTTGAGGAGTATGCTGCAGCTATTGATCGCTTAGA
GAAAGGTTTACAAAAGCTCAAAGAAACAGGTGACACTGTGTCGCGGCTTGAGGTGGAGCTCAAGGTCATTCTTGAGGCCGCTGAAGATAAGAAAGCAGTG
GCGTCTGGTATTGCTGAGGCTGTCAACAAAGAGAAGGCTAATGTGGAAACAGAAAGTAAGAAGGCTGGTGACGAAGCTGCAAAGTGTGCAATCATCCAGG
CTGAAGTCACAGAGAAGCAGCGGTCGACACAAGAGGATCTCGCAAAGGCCGAACCTGCTGTGGAACAAGCTATGGCTGCTCTCGACTCGTTGAACAAGAA
AGATCTGGGCGAGTGTAAAACAATGTCGAAACCTCCTGCTGGTGTAGATGATGTCTTTTCAGCCACAATGGTGCTGCTAGCTGGTGTGCATCCAAATGTA
CAGGTCACTAAGACCGGTAAGGTGAAGGACGTCAAGTGGGATACCGTCAAGAAACAGCTTCTTGGTAACATCCCTGAGTACATCGACTACTTGGTTGGCT
TCAAGCAAGTGGTGGATGACGGTAAGGTACCTCCTATGAACTGGAAAGAGGTGCGTGTGTACTTGGAAATGGAACACTTCAACTACGATACAATCTTTAC
AAAGAACAAGGCCGCTGCCGGTTTGTGTTCGTGGGTCATCAATATCGTTATGTACTACGATATCGTTGTTACGGTCGAGCCTAAACGTCAGGCTTTGGCA
GCAGCTAATCTCGAGCTCGAGGCTGCGAACGCTCGTTTGACTGAAGTGACAGAACTTGTGGCGGACTTACAGGCAAAGCTAGATAAACTGCTAGCCGAAG
CTGCTGCAGCGGAGAAGGAGAAAGAAGACGCAATCAACGCTGTCGAAAACGGAAACCGCAAGATGAAGCTTGCAGGTACATTGACAAACGATTTATCGAG
CGAAAACGTCCGATGGGGCATCAATGTGTTGCAGCTTCAAAAGGAGAAGGACCTGCTAGTGGGAGACGTGTTGCTTGCTTCAGCTTTTATCTCTTACATT
GGCCCATTCACAAAGCCATTCCGTGATGAACTGATCAACAAGCACTGGGTACCGTACCTGCGGACCGCTGCCGATGGTGAAAGCATTGCCATGTCTGAAG
AAGCAAATCCACTACTCATTCTAACAAATGATGCACAGATCGCTCAATGGAACACCCAGAAACTGCCCTCAGACCGCGTGTCAACTGAAAACGGTGCCAT
TGTGGTGACTACAGTATCGATGGGTCGACGACCACTTATTGTTGACCCGCAGTTACAAGCAATCGCGTGGATTCGAGAAATGGAGGCGCATAACAATCTC
ATTATCGTCCGTGTGGGGCAGAAGATGTGGATTGAACGTCTCAAAACGGCCATTGGTACAGATGGTGCCTTCATGATCGAAAACCTAGGCGAGAAGATTG
ATCCCATTCTGGCACCTGTGATTCAGCGCTCGACTTCGCGACGCGGTGCGCGGTACGAAATCCAAATCGGCGACGCATCGGTTCCTTACAACGACAACTT
TCACTTGTATCTGCACACGAAATTGGGCAACCCGCATTACCCTCCTGAGATCCAAGCTGAATGTACTATCGTGAACTTTACTGTCACAATGCTTGGATTA
GAAGACCAGTTGCTGAACCTAGTCGTCTCTAAGGAACGCCAGGATCTAGCTATTAAGCGTGAAAAGTTGATCCAGGAGCAGAACAACGGCAAGATCGAAC
TGAAGAAACTAGAGGATGACATTCTGTTCTACTTGGCAAGTGCTGATGATGATATCACGAACAACCAGCCTCTTATTCAGATTCTGAGTGACACCAAGCA
CAAAGCTCAGCGGACGCAGAACAACATGGAAGCTGCCAAGAAGACTCAAGAGTCCGTGAACATTACGAGTGAGAAATACCGCAGCATTGCAGCTCGAGGG
TCACTGTTGTTCTTCTTGATGAACGACATCAGCAAGGTGCACTCGTACTACATTTACTCACTAGCATCTTTCCAGCAAGTCTTCTTGTCTGGTATCTACC
GCGCTCCACCAGCGAAAAATCTCATCGCAAACGAGGCAGAAGGTGAAGGTGCCGCTGCAGCCGAGGCTCCTGCGCCAACAGAACAAGGTGAAGGTGGTGA
ACGAGCTGGCGATGAAGAAGTTGAGGAGAGCGAACCTGCTGTCCCTGACTTGACGGATGAGGAGATGAAGGAACGTTGTCATGTGCTCATGAATAGTATC
ACTTCTTGTGTATACAACTACGTTCGCCGTGGGCTTTTCGAGCGCAACAAACTTACGGTCGCAACGATGTTGTGTCTGAAGATTTTGCTGAAGGACGGTT
TGTTGAGCGATTCAGAAGTAGAGTATTTCCTCATTAGCAAGGCTCACTCGGATGCTGGCAATGCTGGTTCAGCATCGGAGTGGCTCCCCGCAGCCATTTG
GGCAAAACTGAAAGCACTTGAGAGTTCAAAGGCATTCCAAGGACTGGGGGATGCAATTCAAAACGATCCTGATGAGTGGAGAAAGTGGTTTGCCACAGAG
GATGCTGAGCGACAAAAGGTTCCTGGTGATTTCATAAAGCTTACACCTTTCCAGCGATTAATTTTGCTGCGTGCAATGCGGCCGGATCGTGTCACCAACG
CGTTGCGTACATTTATTCTGGAGTCGTTAGGCGAGGAATACGTGACGCAGCCACCGTTCAACATGGAGGCTACATACGCTGAGACGAACTCGAGTATTCC
AATCTTTTTTGTGTTGTTCCCTGGAGTGGATCCCACACCATGGGTCGAAACACTTGGTAAAGCGAACGGCGTCAGCCTTGAAAACAACAACTTCATCAAT
ATTTCCATGGGTCAAGGTCAAGAAGCATACGCTGGTGAAGCATTGAAGCGACTAAGCACTGAAGGTGGCTGGATCATCTTGCAGAATGTACACTTGATGC
AGTCATGGTTGCCAACACTAGAGCGTCAGCTGGAAGAAGTTGCGACTGAAGGTGCACACGATCTCTTCCGATGCTTCATCTCCGCTGAACCGCCCCCGCT
GCCTGACATGTTGAACATTCCCGAATCACTACTTCAAAGCTGCATCAAGGTGGCAAATGAGGCACCTTCAGATATTCAATCGAATCTACGACGTGCTTGG
GCGAATTTCGGGGAAGACAAGGTTCAAGCTTGCACTAAACCGGCAGAATTCAAGGCTTGTTTGTTCTCCCTCTGTTGGTTCCACGCGATTGTGCTAGGAC
GTCGACGATTTGGACAGCAAGGATGGAGTCGTGCCTACAGCTTCAATACTGGTGATCTCACTATTTGTGCCAACATTTTGCATTCGTACCTGGACAACAA
CGCCTCAGTTCCGTGGGATGATCTGCGCTATCTATTCGGTGAGATCATGTATGGTGGCCACATCACGGATGCCTGGGATCGTCGTACAAACAACACTTAC
CTCACAGTCCTCATCGATCCTGGACTACTGAGTGGTATGGAGCTCGGTCCAGGCTTCAAGTCTCCTAACCCACACGAGTTCTCGTTTGCAGACTACGCTA
ACTACATCGAGAAGAACATGGTTCCTGAGGCACCTCCACTCTTCGGACTTCACCCGAATGCTGAAATAGGCTACCTCACAACAACGTGTGAAACACTTTG
CTACACGATCGTGACTATCGGTGGAGGTGCTGGTGGTGGCGGTGGCGGAGAGGAAGGAGGAGGTGACAAGACAGCTGCATTGCGTGCATCCATCGACGAT
TTGGAAACACGCTGTCCCGAATTCTTCAACATGTTAGATGTGGTGGAGGCTGCCACACCACACTTGACAGAGGAACATGGTCCCTTTGTGGTGGTGGCGC
TACAGGAGTGTAGCAGAATGAACGTGCTGCTACAAGAAATCCGATTATCTCTTGGTGATCTGAAGAAGGGTCTGAATGGACAACTCAATATGTCACAAGC
GATGGAGGACTTGGCAACAGCAATGTCGCTGAACGAGGTGCCTGGACGTAACCCATTCTCGCAGTGTAAGTGGGAGAAGAAGGCTTGGCCATCAACGAAG
TCGCTGAGCGGCTGGTTCACTGACATGGTGAAGCGCCACGAGCAACTTGTTATGTGGGCTGGTGACACCACAGGAGGAGGCGGAAGCTGCTTCGTCACCC
CATTCTCTATCTGGCTACCGGGTCTATTCAATCCGACAGCTTACACGACAGCATGTCTACAGGTCACATCTCGTAAGCGTTTCATGCCACTTAACCAGAT
GACAGTGGAGACTCACGTGACCACGATCCAGGACCCTTCATCCGTCTCGTGCTACCCAGACGATGGTGTATTCGTGCACGGACTTATCCTCGAGGGTGCT
CGCTGGAGCACACTGGATGAGGTCAATGAACGCTATCCTGTTGGTGCGACGCCACCAACAGAATGCGGTGGCACACTGCTGGATAGTAATCCTAAGGAAC
TGCTCTGGAGTATGCCTGTCATGTACGTCAAGGCCGTGACTACGTCACCAACTTGGGAACCTTCATCCGTGGGCTACCTGCGTCACGACCCCAACATCTA
CGAGTGTCCAGTGTACCTCACCCGTTTCCGTGGTCACACGTACATTTTCTTGGCGACACTACCGACCGACTGCGGCAGTGCCAAGTGGGTGCTGCGTGGA
GTTGCTCTAATCTTCCAGGACGACAACTAG