Transcript Name :
Phyli_Pl_113135
Orientation:
(+)
Number of Exons:
7
Description :
hypothetical protein PHYSODRAFT_475569
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Aminoacyl-tRNA synthetase, class II13.462PS50862
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-197
NN-scoreoddsWeighted Score
0.9011.50.003
*** None ***
TypeScore
mitochondrial73.9
GO
Biological ProcessGO IDPrediction Method
aminoacyl-tRNA ligase activityGO:0004812IEA
tRNA aminoacylation for protein translationGO:0006418IEA
*** None ***
*** None ***
Sequence
        1003 bases(100 bases per row)
ATGCTGGGGCTGAGGCTGCATCGATTGGGGGCCATGGCGAGCGAGACACGTCGCTCGCTGGCTGTAGCCACCAAGGCTAAAGCTGTCAGTCGCGTTAGAG
GCACGAGAGACTTGCTGGCAGATGATTCCCAGCAGCACCGTGAGGTGCTGGACACTCTGCAGCGGACAGTTGAGCGCTACGGATTTCGATCGGTGCGTGT
AAAGTGTCAGAATTGCGTATGGTATGATAGATACATTGGTAGACTGACAGTTGGTTGTGTGTAGATCCAAACGCCGCTGTTGGAGTACACGGACTTGTTC
TCTCGGTCGCTGGGTGATGGCTCCGACATTGTCATGAAGGTGGGAGAGCACATTCGAAGGTAGAAAGAAGATGGGATGGAACTAAATGCTGTTGGTAGGA
AATGTACACGTTCAAAGACAACTCAGGCAAGAGCGTGACCCTGAGACCTGAAGGCACTGCTGGTACGCCATGTTTTGGCAATTTGGTGTGATTCAACAGT
GATGAATTGGATGGTTCTGTTTTTCAGGTATCATGCGGGCCCTTGTGAGCAACAATTTGCTGTTTTCACTACCCCAGAAGGTCTCATATTCGGGTAGCAT
GTTCCGGTGTGTGAAGTATTGTTTGCGCTGTACGTAGAAGATGTGATCGTTTTAACTAAACATTCATTGGTTTAGGTACGAACGTCCTCAGCGCGGAAGA
TATCGGGAGTTCCAACAGTTTGGTAATACTTCTATGCAGAATAGCTATATATTGATGACCTATGGTGATCATGTATCATTGTGTCAGGTGTGGAATTTGT
GGGCTCTTCGGGTCCATCTGTCGACGCAGAGGTACAATTTGTCACGCGATTGTTTTGTTAACTTAGTCACTGTAGTAGACTTACAGTTTGGTGTCAATAT
TGTCATTGCAGGTTATTGCCATGGCTGCTGATGCTTTGGACGCTTTGGGCATTAAAGACAAAGTCTTGTTGGAGTTAAACTCTCTAGGTGACAACGAAAG
GTG