Transcript Name :
Phyli_Pl_113111
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_343758
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Phox homologous domain11.529PS50195
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-316
NN-scoreoddsWeighted Score
0.6771.7420.003
*** None ***
TypeScore
nuclear60.9
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        950 bases(100 bases per row)
ATGAACTTTCAGAGCGGAGTGCAGGTGTTTATCCCGGCGGCGCTCAACCGACCCACCCACACATTGTACAGCATATGCATGTTGGTGCAGCCCACCAACC
AGGAATGGACAGTGAATCGTCGCTACTCGCAGTTCCTGCAGCTCCGGAAGGACATCCAGCACAAACTCGCCACGCGTGGTGTCTCGTGTGCTAATTGTGC
CAGCTTTAACCGAGCCATCAGCAAGTTCCGCTTCCCAGGCAAGTCACTACTGCGTACCAATTCAGTGGTGCGTCACCGCGTTTCAGCCCTACAGGAATTC
CTCAAGCTGCTGGTAGGACGTGTCTATAACGACCTCCCGAAGTGTGGCATATGCGGTGAAGAGATTAAAGACATGATGCGGCCGTTCCTCATCCGAGGAG
CTCAACCGATGAACGGTTCCATCGTCTCCAAGATTAACAAGTCGCTGTCGCTGGAATCGTATGCTGTAGTGGACCAACCTGTGTTACCCGTACCGGAACC
AGCGCCTCCCATTTCTCCTTCACTGGCTGACAGAGAATTGTTTAGCGCCAGCAAGTCATCGAGCAAGCCCATATTCACACATAGTCAGATTTCAAGCAGC
AAGTCCATCTTTTCACGCAGCAAGGCGATGATGAGTACCAGATCTGACGATGCGTCCACAGTGCCGAACGAGTCGGAGGACCCCATCATGGATTATTCAG
ACAGCGATGACGATGGTTATGGCAAGAAATACGACGACCAACGCTGCTACGATGAGGGTGTGCCTCTTGAGGAAGCTATGAAGCAGGTGGTGGTGCCCAA
GGGAGCTCACCTTACGTGCGAAGAAGTGGTTGTTCGGCTCACGTCGATGTGGGCTGCGTATGACCTGGATGAAGCACTCTCATCTTTGCCACCTGAGCGC
CTCTCACAACAAGCCACCTTCTCAGTCGACGATAAGGAATACGCCTTCTA