Transcript Name :
Phyli_Pl_113122
Orientation:
(+)
Number of Exons:
6
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-348
NN-scoreoddsWeighted Score
0.6311.040.002
*** None ***
TypeScore
mitochondrial43.5
GO
*** None ***
*** None ***
*** None ***
Sequence
        1348 bases(100 bases per row)
ATGGCACTGCGACTGCGTCAATTGCAGGTGGTGCACCGTCATGGCGACCGCACCCCGTTGCTCAACATCTTCAAAGGGAGTGTCAATGCTCGTTCTGAGG
AGCAGGAAGCACTACTGTGGGGGCGACAGCTCCCGGCGCCGACGCAACTCGCGCAACTCCGTTCCAAGTTCAGTGTCGAAGTGGGCGGTGAAGCTCAAAC
TTCGTTCCAGCAGCGGCCGTTTGGGTATTTGACGTCTCGAGGTATTGAGCAGATGACGGAGCGTGGCAGCCGACTGGTGAGATCCAACTGATGTTCTTGG
GGGAGATAACTCACGGACATTGTGATTCTGGTAGCGAGGGTTTTGTAAGAATGAGGAGTTGCAACTGGATCAAGTGACACCTGATGAGGTGCAGATCTTC
AGCAATGCGTACACACGTACTCAACTCAGTGTGCAGGCACTGCTAGACGGTATGCTTCGTGACCAACCTCAGTTGACCCCTCAAGTGAGTGTGCTGCCGC
CGGAAAAAGACATTATCAACAGTGAGTTCTGAACTGAGTTTTTGGGGTAGTGAGTTAACGATGTGATGATGTAGCATACCCGATTTTCCCGGAGATCATG
CAGATGAAAGCAGACTTGGAAAAGGACAATGCAGAATTTGCGGCGCGCGAGCACGAAATGGCTCCGATTAAACAGGAGTTGACGAGGTTGTTTCCAGCGG
TGGATTCGGGCCAGGTACCTTTTACCTGGTTAACCGCCGCTGACTACTTCGTTTGCCGCCGCACTCACCAGGTTCCTTACATTCCTGGCACTGAAGTGCA
TGGCGATGCCACGGAGAAACATCTCGGCTTCCGGTTCCACCAGGTAAGGGATGTTGTCGAAACTGTACATGCAGTCGTGAATTTTAAAGGGGATTGTTGT
TGTATCTATAGTTCTACTCGCATCGGACGATTTTGAAGCTTGTGGCTGGACGCTTAATGCACAATGTGCTCCGTGAAGTAGGTCAATTTACGATCTGAAA
GTGTAGTTGATGTGCATGACTAATAATCATTACGATATTGTAGATGCAAAAAGCTCTCTGGGGTCACAACGAAAGCAAGAAAGTTGTGATCTACAGCGGA
CACGACGTATCGCTATTGTCCGTCCTCCGAACTATGGACGCTGAAATCGCAAACGACATCAATTTTTGGCCTGAATACTCTTCTGCACTCGCATTAGAAT
TGCTGGAAGATGAGAATGGAAATTTTTTCGTTCGGGTGAGACTGAACGGTGAAATCCTATCCATAGGTGACGGTGTTCCAGATGGCCTCTGCTCTCCTGA
TCGTTTCCGTGGCATGGTTTCAGAGCACATTGGGGGTCACGCTGACTA