Transcript Name :
Phyli_Pl_113152
Orientation:
(+)
Number of Exons:
6
Description :
hypothetical protein PHYSODRAFT_476799
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Regulator of chromosome condensation, RCC10.000000000000012PR00633
Regulator of chromosome condensation, RCC10.000000000000012PR00633
Regulator of chromosome condensation, RCC10.000000000000012PR00633
Regulator of chromosome condensation, RCC10.000000000000012PR00633
Regulator of chromosome condensation, RCC10.000000000000012PR00633
Profile scan predictionP-Valprediction_id
Regulator of chromosome condensation, RCC110.424PS50012
Regulator of chromosome condensation, RCC19.579PS50012
Regulator of chromosome condensation, RCC112.213PS50012
Regulator of chromosome condensation, RCC115.79PS50012
Regulator of chromosome condensation, RCC114.685PS50012
Regulator of chromosome condensation, RCC114.745PS50012
Regulator of chromosome condensation, RCC111.509PS50012
B30.2/SPRY domain17.407PS50188
HmmSmart predictionP-Valprediction_id
SPla/RYanodine receptor subgroup2.3e-25SM00449
Kelch repeat type 10.00021SM00612
Kelch repeat type 18.3SM00612
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Regulator of chromosome condensation, RCC1IPR000408
SPla/RYanodine receptor subgroupIPR018355
B30.2/SPRY domainIPR001870
*** None ***
InsideOutsideTMhelix
1-1708
*** None ***
PositionContextScore
802DGNRQRR|WN0.542
1631RAVRLKR|QD0.538
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        6455 bases(100 bases per row)
ATGGGACAGCAGATCTCGCTCCCGGCAGCGGTGATGCAACCGCCGGGCGAGCGCGCGCAGTTGCGCCCACTCCAGGCGCCCTACGTGCCGCTCTGCGACG
CACTCAAAGCCGGCGACTCGGGCGTAGCGGTGGCCTCAACGGCCGCGGAAGATGCAAAGGACACTTTGGACAAGATCCTTGAGTTTGGCGCCGCGCTGCG
CTACCTCCCGAAAGGTGGAAAACTTACAGCAACCTAGTTGAATTATAACAGTCTGACACTTTAACTACCGCTTGGTTGTGCCCTACAGAAAAAGAAGTAT
CCGGACGCCTGCAACCACGCAGCCCGGAGCAACAGATGAAAGAGATTATGAGCTCAGTGGATTCGGTGGACGAGTTGTTCCAACACATTGCTCAACTGGC
AGGGCTGCCGACTCAAGACGGACTCAACCCTGCACGAGTTGATGCTAAACGAGACGCAGGGGAGACGATGCCTGGCGTTTTTGACGCTCGTGTGGCGAGC
TACGTGAAAAACTTGCAGACTTTGTACCAGATGACGAAGAAGGAGAAGTACCGGTATGAGCAGCGACTGCTTGGTGCTAGGGCACACGCCATGTCGTTGC
GCAAAGTGTCACCGCCACCACTACCACTGCCAACACAAAACTGCTTGACCATGGGATGGGACCTTGTGGTCATGTTACTGAAGGCTACACACAAAAACAA
TCCGCAACAATACGAACAAGCGCTGCAGAAGGTGAAGGATAGTCTGAAGTCTCTCAAACCGACAGCCTACTCAGACAGTATGTACCTCGCGCCGTCCGCA
TCATCGGCATTCGACCTTCTAAGTGAGTGCCTGGGTGATCTTGCGTATCCAACGACAGACGGAGTGTCTGAAGGAGATATACGTATCGGAGCTCACACTA
TTGAAACATTGGCTGAAGTCGGGTTAGCCCGTGGATCACTTGCAACCATGCTCTTCGTGGTACTGTGGCTTGTGAAGCAACCACCTACGAGCTTGGTGAA
CTTGGAAACATCAATAGCTAAACTTGCAGCACTCAAAGAACAACCAATGTACGGGAAATGCGAGGCTTCTGGGGAACTCTACAGTTGTGGACAGAACTCA
TACGGAGAACTAGGTACAGGAGACGATCTCGAGCGACATCAGCTCACCAGCGTAGCACTTTGTGGTTGGGACGATATTCGCCAGGTGGTTAGTGGCAACG
AGACACTGGCGGTTCTCACAAATGATGGCGTCGTATTAACTTGTGGGCTCAACAAGAGTGGACAGTGCGGTCAAGGACATTTTGATGAGCGAGTGATGAT
GCTCAGACCCGTGCAGGCTCTACGCTCCCAGCGAGTGAAGTTTGTTGCTGCAAGCAATGGCTGCGAGCACATGATCGCGCTGACTGACACTGGTCTCGCG
TATTCTTGGGGTTACAATGATCGAGGGCAATTGGGGCATGAAAATCTGACGACCAAAATTCATGTGCCTAAGCTCATTGAGTCTCTAAAGGACAAAAAGC
TTGGATACGCCTCTGTGAGCTACCATCACAGTGCTGTGATCACGGATTCTGGAGAACTCTATACATTTGGAATGAATGATTGTGGTCAGCTTGGACTTGA
TCACACACAACACCAGTCGACTCCACAGCTTGTTAAGAGCCTCGAGGGCACGGAAATATCCATGGTAGCTTGTGGGCTGTACCATACAATTATCTGCACA
GCTAGTGGGGAGCTGTATACATGCGGAAAGAATGACTATGGGCAATTGGGTTTAGCTCACAACCGTCAGATCAAAGTGCCTACCCTCGTTGCTCTTCCAA
ACGAGATGGTATGTTTTGTTGCATGTGGATACTACCACTCAGTAGTTGTTACTACTGGTGGTCGAACTTTCTCATTTGGTCGTAATGACTACGGCCAGCT
TGGAATCGGGAGTAAGGTCCACCAAAATGTGCCCAATGTCGTGGCCTTATCTGCCAACACGCGGATGATGCGAGCCACGTGTGGGTGCTACCACACTGTT
CTGCTATCAGAACAGGGGCAAGTCTTCGTGTTCGGGCGAAACAATAAAGGACAGCTTGGAAATCGTGGAAGTGCTGATGCATTACTACCTGTTCCCCTTA
AAGTCCGCCCAGAGAAGAATTCCCGTCGATGCGTAGACGTCGCTGCTGGTTTTTATACCACATCATTAATTGTTGAAAGAAAGCGTGAGAACGACGATGG
TGACTCCATTGTCTTGGATCAATCTTGTGTCGTTTCTGTTTGCGGTCGTGTTGATATCGATCGTTCAGGCGAGATTGAGGGTCTAAGTAACTTTGGATCA
ATTTCCACGGTTGGTGTATCGCTTTTTCGAGGCAAATGGTTTTATGAAGTAGAGGTGGTTACCAGTGGTTTGATTCAAGTTGGATGGATCGATGGATACT
TCCAGGGAAGCTCAGACCAAGGTGAAGGAGTCGGTGATCATACCCACTCATGGTCCTATGATGGTAACCGCCAACGTCGTTGGAATAGTGGATCATCTTC
GTATGGAGAGAAGTGGCGGGCTGGTGATATCATAGGCTGTCTGCTGGATTTCACAACGCAAGAGATGACATTTTTTCGGAATGGAGTCAATCTCGGCGTA
GCATACTCGGAATTCAAATGTTCCGTAGAGGATAAACGGTCAGGTATGATGCCTGGTATCAGCCTTGAGCGGGGTGAAATCATCCGCATTAACCTTGGCC
ACCAGCCTTTTGCTTATCCCCCGACGACTGGCCACGTGTTCGAGAGTATTTCTCGTGCAGTCATGATGCCTTCTTCAAGTGCGGTTATTAAGTCATCAGC
CGATCAAATGTCAGGTGATGCAACAACGCATCCCCCATCTTTGGAAGGATCAGCCTCAGCTTTAATTGGCAACAAGTTGTTTGTTGTTGGAGGAATCGTT
GTTAGTGAATCACCTTTGCCCCAATCTGCTGAGCCTACGAACCAAGTATGGATGTACGATACTGACGAAAAAAGCTGGGAAAGATGGGCGGACTTCCCAA
TTGGAATTTGCAACCATCAAGTTGTGATGATAGACGAGAATCAAGTTCTTGTACTTGGTGGCGAAAGCAATTGTGCGGCATCGCGGCATATGGACTTATA
CAAGTGTTCAATAGTAAGAAACGCGGACGGATCGCTCCCGACATGGACCTTGATTCAAGCTGCTATTGGTGCAGCGACGTCTATGCCCCAAGCTCGTGCA
TTTCATACAGCTTCAACCATTCGCGTTCGTCTTGACACTATTGTGTTCATGTACGGTGGAAAATCGGTTGATGACGAAGTTCTTGGAGATGTCTGGTATT
TATCCCTCGATGATTACACTTGGTCTCGGTTGCCTAGCTCAGTATCTCTAGATCCAGGCCCACGAAATGGATGTTCTTCTGCTGTTATCGGAGAGTGTGT
ATACATCTTTGGTGGTCAGGACCGTGAAGAGAAGTTCAGATCTGATCTCTGGCGGTATAACACATTCGACCGGCTTTGGCACTTGTGCCATGATGATAAC
ATTGGGGCGGGGTCGAAAGACGTGGTTGGGAGTCTATCAGGTAAATCTAAAAGTGAGTCGCAGCCTATAATGCCAGACGGAAGAGTGAGATATAGTATGT
GCTCTGACCTGGGAAATATTTGGATCTTTGGAGGCGTCAATAGGACGAGCACTTTCTTAAGCGATATGTGGTGTTTCTCTGTGACATCACAAAAATGGAA
TCACGTTGAAGTAAATACTCAAAACGAACTAGATGGATGCTGCTCGGCTGGACTATATGCTCTAACTGGCACAGTAACTGCGTTGGCTAACACTGATTTC
GAAACATCTACTTCACAAGTCGAAGATTTACTTCTTTTCGGTGGCCGCATTAGTGTTCACGGAAAAGTGTCATATTGCAGCAAAGTCCGAAAAGTATGTT
CTGATAACTCATCAGGATCATACAATCTTGATATGACGAAAAACGTATCGACAATTGGAAAGGCAGGAAATATGCTTAGTTTACTTCGTACAAGGTGTGG
CGCTACTAACAGGTCAAGCCAACATTGTGCAGCGGAAGCCTTAGACTCTGCTGTTTGCTTGCTATCTCATCTGGATCGATTAGCTGGAAATGACATCCCA
ACAGAAGATGCAGATTCTGTTCAATTATCACGGTGTTTGTACCGGTCGCTTTGCATAGATCCCAAGGAGTCAACGTTTTCGGCATTATACGAGCTACTGG
AAAATTTAACATCCCACGTCTTCACCACAGGTGTACTAGATGAAAAACCTAGCACCACACTGGTATCACACGCACTATATCCCTTGCTCGTGACAATAAA
GCTACTCAAGCTTAATTTCTATGAGGTACGGAAGGTATTGATATTTGTTGTTTGAGATTAATCGTTGAACTAATCACCCGCTTTTTAATGCATTTGTCCC
TAATAGTTTTCCCGCAGTTGTTTGGATGGATCAGAGATTGGGTTACCAACTGCAGCATCCCAGCCTGGAGGGGTTCTCTGTTCAATTCGTGAAGTACTCT
TCATGATTGCGGACCACGTACCAAAGTTATCGATGTCGGGTGAATTGCAATGGTTTTATCACGCAGTGAAACAAGAAACGGCATTGGCAATCTACTATGG
GTTCCCAACTCTTTTTCCATCTCTTTTGGACAGGTTGCAAGCCATGAATCGCCTGATGGTAAACAAGCAAAATTCTGAAGCGGGGTTAACCCCAGCCCAG
AAGTTATTAATTCCTATGCTTGTTCCGCGCTTCACGTCGACAAAAATTTTGTTCCAACTGCTAAGTGACCCTGACATACTATTCAAATTGGACACTTCAT
CAGGCGATTCTGTTACTGAAAGTGTGATCACATTCATGAGCACATTGCTGGATGCATTACGAGAACAGACAATGAATGCAATTGAGCACTCGTCACAAGA
TATGACCAAGCTCATAACAAACTTAGATGTTATTACAAGCCAGCACGAGTTTAAATGCCTCAACATTATGCTTCGCGCGACAATATTCTGGTGTTCGTGC
TCTGTCAGTCGAAGCTGGATGATCATTGAATCGGTTTGCACGAAGTTGGTGGCATTTATCTCTGAGTGCGTTGACGAATACGATACGAATCTGCTCGAGC
AGAGGCAATATTTTCCTATTGTGATCCAGCACAGTTTCTCTGGAAAATTGCTGCCGTTTATATTACTCAGCTTGTTTTCCTTACCCTCCGTCAGAGACGC
ACTTCCCGCTATGCTGGATCCATTCTGGGCTCAATTAGAAGGTCTCGCGATGAAACTTTGTACTTCCCTTGCGGTCTTGAGCAAGCAAGGGCTCTTGCAG
AAATCCAGTGTGATTGTTGATACACCTGGTGGCGGAGACAATAATTGCGAAGTTGACTTCGTGGAAACAGCGCTTGCATCCGTTTCAAAAGAACTCTCAG
TGTGTCTTTTGCAGCAGAGTACCGGATCGTCTGTCACGTATGGTCGAATATTCAAGAGCTTGTGGGACAAAATCATCCAATCCAAGGGGTACATGTTTTG
GAAAGTAAAAGACTTGGCAGAGGTGGAAATCCGACGGGTAACTATTCCTTCGGACCTTGCGAAACTATTTGGAGCCGAAACGTTGCTAGTGAAAATCCAA
AAGATTGGAACAGAATCTGGAGTACTAGCATACGACCCAAAGAGTATTTCCTTCGTACCCAGTCGGACTATTCTCTCGCAGCACATATATCCCTTAAGCA
ATGACCCATTGCCTTCTCCGGGGGGAGTTGGACCTGATGTGAGACCGCCTCCGGCCCCACAACCACTCACAAAATCGTCTCCTCCACTAGTATGGAGTGC
TGACAAAACGATTGAAGAAAGCTACGACTGGCTTAAGGACCTCCAAAAGGTGATAGCTTGGGTGGGGAGTCACTACGCCGCGACTTTGATAGTAGGTGGT
TCGGTGGATAGTGGGATCGTCGTCAATGAGCGATGGCTGCACTCCCCACTGTTCCGGGGTGGATTAGAAGAAACATGGCCTAACACTACTTTAGGAAATA
ATGAAGTAGGTCGAAATGAATCACTACTCCTACAGGTGGTTGACAACGTCGGCAATGGCAAGAGACTTTTGGACAAAGTGCGAAATGCTCTGGACCCTGG
ATCCGCCTCCGGTATCGTAAACCCAAAGCTTCGAGCTGTGAGATTAAAAAGGCAAGACAGCGTGGAGGCGACATTAGAAAAGAGTGGTGGAATCGAGGCG
GTGGACCGTGCAGTCCGTGCAACTTTTGCTGCTCTGTTGAAGCATACCAATATATCCTACACTACGGAACCTATTTCAAAGAATGGGGCACTAGCTGAGT
CAGTCGTTGATGCTTGGAAAGCTTCTCTACAACTGCGTCGCTGGTAAATGATCCCACCAGATTTAACGACTGTTGGAGTGTTACTAACACAACTTGGCTT
GTTTGCGTTTTAGGATCGTGAGAGAACAGCAAAAACTGGCGGCAGCTTTCAGGTA