Transcript Name :
Phyli_Pl_113114
Orientation:
(-)
Number of Exons:
1
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, CCCH-type16.774PS50103
Zinc finger, CCCH-type14.652PS50103
Myb-like domain6.644PS50090
Zinc finger, CHY-type18.019PS51266
HmmSmart predictionP-Valprediction_id
Zinc finger, CCCH-type0.0000036SM00356
Zinc finger, CCCH-type0.015SM00356
SANT/Myb domain0.00017SM00717
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Myb-like domainIPR017877
*** None ***
InsideOutsideTMhelix
1-724
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
chromatin bindingGO:0003682IEA
zinc ion bindingGO:0008270IEA
metal ion bindingGO:0046872IEA
*** None ***
*** None ***
Sequence
        2174 bases(100 bases per row)
TGGCACTGGAACGTCGCTACCATCTGCAGCTGAACGGCGAAGACACTGTGACGCAGGATAAGCATGTGCGTTTGTTCTTGAGTCTGTCGGATCCTGAGCT
GCCGACGCGACTGAAGGGCCAAGTGGAGTTGCAGATGGTGCTGCCTGGAAAATATCCGATGGAAGCTGCCCGAGTGGACTTTACACAGTGGAGCAGTCGA
CTGTCGGGTGAACAGGTTGAAGCGCTGAATGCCGCGGTGAATGAAAGAGCACAGCAATTATGCGGTGGCTTCTCGCTTCGGAAGCTGCTGACTTGGCTTG
ACAATAATTTCTGGCGGATTATCGCACCATTTGAGAAAGAGCTGGAGAACCAAGAGGTGACAGCAGACAGTTATGATCAGATCGATGAGTTGGAGACATC
TTTGCTTGGAGAAGTGTTACCAGCGGCAAGTAATAAGAAACTAAAGAGGAGGCGTGGTCAACGACCGTGCCGCTTCTTCGCAAAAGGTAATTGCAGAGAT
GGAGAGAAGTGCAAGTTTTCGCACTCAAAGAAGGAGAAAAAGGCGGAAACTGACAATGAATCAGCTGAAGTTCTTGATGTCGGTACTGCATCAATTGTCA
AGAAAGCTGACCATACACAATCACTTGACACAGCGAAACGTAAAGTAGCTCCAGAACAGAAAACAAAGAAACCTCGTGTGCGTAAATGTAAATTTTTCGC
GCAGAACAAGTGCCGCGACGGAGATAAGTGCAAGTTCACTCACGACATTAAGAATGCCGGAACAAATTGCAAGGGACAAAAGCAGCAGGAAGCTGATGGC
TCTCCACGAGCTGTTGTCGTGCGACTGGGTGCTCCAACTGGGGATACAGCCAATGATCAAGCCACTGCGAAGGTGAGACACACTTCTCCGAATCCTATCA
GCGAACACAGTGACAAACGACACGAAGATAGCAAAGAGTGGTCAGAGCCACAGCAACGAGCACTCGACTTAGCGTTAAAAAAGTACCCAGCATCAATGAA
CAAGAAGGAGCGATGGACACGCATAACAAACGAAGTCGAAGGCCGATCCCTGAACGAGTGCATCGACCGTTTCAAGATGCTTTGTGAGCTTGTGCGGCGC
GGTGTGGATCTCACTACCCCTCAGAAACTGGAAGTTGAAGTTAAAGAGGAAGAAACAGAGCATCTCAAAAGCGGATGTCATGCTCAAAACTCTAAAATCA
TTCCACTAGAGAAGCGTGTATCCGTTGAGACCGAGCCGGAAGTGAAGGGCACGCAGATTTGTCTGGAAGATTTGTTCCTGCACGAAGTTGGGACGTTAGT
CGCTCATCGACTCGTTTGCCAGGTCCAATGCGAAAATTGCCCACTCAAGTTTGACGCAATTTTGAGTTTGGATTCTGCAGAAATCCAGAAATGGTGCCCT
CGTTGCAGTGTGCTTCATCACGTGCTGATGAGACCTGTGTTTACCCATTCGCAGAGCAATGTGCTAGCTTATGTAGACACTGAGAACTGCTCGATTGTTG
ACGTGCTCCCGACCGATGTGTTAGCTACTTGCTTGGAGTGTGGATGTGAGGCATTGCTAGAGAGGATTACACCAAGGCAGCGATCAGAGCAAGCCTGTTT
TTCCTGTCACGTTAAACTTGCTGTGATGGCAAAGCGCTTCGTGGCCGTCCAATCGGAGGGATCAGGAAGTAAACGGAGTAGCTCACCTGACGGCACTGCA
GCTAGGATTACCAAGGGCAACAAGAAGGGATCCAAACAAGTCGTGGAAACGTTCGTTTTGGGGCAGCCATTGCCTCGTAATGGAGTGTGTGACCACTATA
AGCACTCATTGCGCTGGTTTAGGTTCCAATGTTGTGGCAAAGCGTTCCCGTGCGACGTATGCCATGACTCGAGTGACTGTCCTGAGGCCAATTTGGGTAA
ATTTGCCAGCCGAATGATCTGCGGCTTGTGCTCAAAGGAACAATCGAGCTCGGTGAAAGTGTGTTCCTGCGGCAACGATGTTGCCGCCAAAAAATCGACC
TCACGTCATTGGGAAGGCGGTGCTGGGTGTCGAGATTCTTTGCAGATGTCTCGTTGGGATAAACAGAAATATCGAGGTATGAACAAAACGGAGAGCAAAA
AGTTTAAGCGTGTCGGTGCAGAAGCCAAGAGGCGCCGAGAGAACGCAAATGGGAACGCTAATGCACAGCCTTAG