Transcript Name :
Phymu_g13520
Orientation:
(+)
Number of Exons:
3
Description :
hypothetical protein PHYSODRAFT_330122
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-386
NN-scoreoddsWeighted Score
0.6691.8080.004
*** None ***
TypeScore
mitochondrial565
GO
*** None ***
*** None ***
*** None ***
Sequence
        1976 bases(100 bases per row)
ATGCTACGTCAGCTCCCTCCTCCACCGTCACTGTCCCAGCTGACCGCCACGCCGGATGAGCCGCTATCTCCTGTTGCGTCTTCAGGAGTAGAGCCGTCCA
GTCAAACCTCTCAAGGGGCCGGCATCCAGCTAGCGCAGGACACCAGTGAGGCCAGGACTGCATCCAgtcaaaaaaaaaaaaagtagCGTGGAGGAAGCCC
gagaggaggacgaagacagcgacgaacCTGACGACAGCAATGACGAAGACTGGAGTGATGCAGATGATGTTTCtgtggaggacgacgtgtTGACAGGGGA
GAGCGAAGGTGAGGTCGAGGATGCAGAGGATATAAGTATCAATCTGCTTGACGTTGATGCCCAGCAATTGATCACGCGCCTCATTCATGACGACTCATGC
GAACGGCGTTGCCTTATGGGAAAAGCAGGCGAGCTGACATCTCTGGTGTGTTCCTTGGCTCAAATGACAAAATCGGAGAAGATTACGTGCATTCTAACTC
TCATTGGAGTGCTCATGCAAACCGACACCGCTGAGCGACGCCGTGGCAAAGGAGAACGTGAGAAGTTTCACTACTATTTGCCGTTTGTGGGGCACGTGTG
TCGTCCATCATTTGCGAGGAGCCTTGGAGTTCAACCCCTGACAATCCAACGCTACAAGCAGCGCATTCGGGACGGCAACATCGCCGTAAAAAAGCACAGC
AACCAGCTCAACAAAAATGCGTCCAAGGTGGATCTCGTTTGGCTAGTCAAATGGTTTCAAACCTTTGCATCAGAGGTTGGAGAGGTGGTACCTGTGCGAG
TCCGCATGCAGAAGACAAAGGACGGAATGGTGAAGAAGTACTACATCCGAGAAAACTACACACTCTTGCCTGCGACATGCACATGGGATACTTTGTACGA
CGAGATGCACAAGTTCGTAGAGCGTGGCTTATACGTGTATGAACCAGCACCCTCAACGTTTCGCAAGCTCCTGTCACTTCACTGCCCGACGATCAAGATC
CGATCCTCGCAGTCGAATGTTTGCGGTTTTTGCACGATCTATCAAGCTCATATGCGCCGAGGACCAACAGCTGAGCAAATGGAAGAGCTAGGACAGCACA
CAGAATCAGCAAGGCGAATGAGGTGCGTGGACACAGGTATCAATTTGTTCTATCATTGATTTCTAATGAGGACATGAGTATCCTTTTGATTGTTTTGGCT
AGGCGAGAGTACAAGAAAGACATTGCTGACGCTCACACTTCCGACAGCACCACGCCGTGCAAGTGATGGACTTTTCGCAGAACCTAACGATACCGTCGGT
CACAACCACGCCATCGCAATGGTATTTCTGCTCTTTCCTCGAGGTAAACGTGTTTGGGATGTTCTACGAGAACGAAGGAACACAAACAAACTATCTGTAC
GACGAATTTGGTAGCGGAAAAGGGTGCGACCAGATCAACTCTatgctccagcacttcatccGAACGGTGTTGGTTCCGTCGGGCAAGAAGCGTCTGGTGG
TGTACGCCGACAATTGTTCCTGcgaaaacaaaaacaactACGTCATCCGCTTTTTCCGGGTACAAGTACAGATGGGGACGTTTGAGCGAGTGGATTACAA
GTTTTTTGTCAAAGGACATACTAAGAATTCCTGCGACGGTGGGTTTGGGCACATTCGAAAGCACATGGGCCGCTCAGACTGCTGGACCATGGACCATGTA
GTTGCTGCGGTCAACGATGCAGCTGCATCCAGTCGGACGGTGCACATTTCGCGCGGCAACTGTTTTTTTAAAAGCCACAAGCCcttgctggaagagctct
aCAAAAAACTAGTTGGGGTACAGCAGTACCAGATTTTAAGCATGGAGCAGGGCAGTCCAGGCGTGGTGTTCTGCAGGAGAGGACCAGACGATGAACCTGT
TGAGAAGGACCTCCGCCGCAAGGTAGATGGCATCCCCATAAATAGTGCGAATGTGACCCGCATGCTGGAGCACTTC