Transcript Name :
Phyli_Pl_107140
Orientation:
(+)
Number of Exons:
8
Description :
protein kinase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Protein kinase domain47.594PS50011
HmmSmart predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain0SM00220
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-440
*** None ***
PositionContextScore
99FIKRKKR|EG0.669
257HRQRSRR|PR0.512
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        1884 bases(100 bases per row)
ATGGACGCGTACGAGCAGGTCCGCATCATCGGCAAGGGCTCGTTCGGCGTCGTCACGCAGATCGTGCGCAAGGCCGACCGTAAGGTGAGACGCAGCGACC
AGAACAGGACACTCAGGACATTCAGGGACCCTCCAGACTTTATACTGACGTGAATATGATGCTAAATAGATGCTGGTGTGGAAAGAAGTCAACTATGGCG
CCATGAGTGAAAAGGAGAAGCAACTCATCGTCAGCGAGGTGCGTTGAAGACTCGGTTGTTTACGAGATGGAAGGGGCTGACTTTATGGGTAATTACTGCA
GGTGAACATTTTGAGGGAGCTACGCCACCCTCACATTGTCCGCTATCTGGACCGTGTGATCGACAAGCAGGCCACCAAGATCTACATTGTCATGGAATAC
TGCGAGGGAGGTGACCTCGGACAGTTCATCAAGAGGAAGAAACGGGAGGGGTACGCTATTCATGATGCCGATCGTGGAGCAACAGCATGTATCATTGTTG
ATTCTCCCGGTGATTTCTGACTTTTGTGGATGATTTTTTTGATGACAGGTCCTACATCGAAGAAGGCTTCATCTGGCACATTTTCACGCACATCTTCCTC
GCACTTAAAGAGTGTCATCGTCACCGCGAAGGAAACGCTATTCGACCTATTCTTCACCGTGACATCAAGCCTGGCAACATTTTCCTAGACTCCAACGTAC
GAAGCCGTTTTATACTGTTGTTCCTGTCGTATTGCGTAGCTGTGTATGCGTGTCTGACAGGTTTGCACTTTATTTTCCCATAGAACAATGCCAAGCTCGG
TGACTTCGGTCTTGCCAAGGAACTAAGCAGTGAGTCTCGTTTCGCCCAGACGAACGTCGGTACCCCCTACTACATGAGTCCTGAGATGGTGAACGAGATG
ACCTATGACGACCGTTCGGACATTTGGGCGCTGGGTTGTTTGCTGTACGAGATGGCTACTCTATGCCCTCCGTTCGATGCGACGAATCAGCTCGCACTGG
CGAAAAAGATTAATGCAGGCAAGTTCACCCGTATCCCGTCGCAGTACTCGGAGGGTCTGTTCCAGGTCATTCGATGGATGCTCCACAGACAACGCTCTCG
ACGACCGCGAATTGAGGACTTGGAGCGTGTACCACAGTTGCAGCAGAGATTACGTGCGTACGCTGCGGCTAGTAACCCACAGCCAGCCGCTGACCAGAAC
CTGCAGACATCCTACAACCAGAAAATGAAGGAGCTGTTGGGCATTGAGGAAGACCTGCGCCGACAGGAGGCAGCTTTAATGGCTCGTGAGAAAAAGCTGA
AAGGTATGTGGATCAGTTATTACGTACAATTATGTGCTGTAGATCTAACAGAATATCTATTCATCTCCTACAGAGCTGGAGGTGGACTATATGCGTCGCG
AAAGTGAATTGAAGAAGCGGGAGCAAATGGTAGAAATGATGACGCGCAAGTTGTCGTATAACGCGGCCAAGGTCGGATCTCCTACAACGTCTGATGACTC
TAATTCCAGCGCAGACAACAACTTTGGTCACGGTGGACCACAGAGTCCTAAACGAGGCAGCGGCGGGAGCCCCCCAAGTCGTGCCGGTTCAGGTGACCTG
AATGCGAAAGTTGCTGCAGAGGAGGTTCCGCAGACAAGATCTCAGCGTGGCTATCCTGCCAAAGGCCAGGGCAGCCCTTACTATGGCCCAACGGGTGATG
TCAGCTCGACTCCGTCGACGTCAAACCGACTCCGTGACGCCCCCGAACAAGTCGCCAACTTGGTAAGTCAACTCTCTATAAGAAAGGTCTGAACCTGGTA
AGTTCACCCGGTGTTAATTTCTCTAATTGACTTGGCTGTTTCTGGATTTTTTCAGATGAAGGGAATGTGGAGGAAGAACAATTA