Transcript Name :
Phyli_Pl_100384
Orientation:
(+)
Number of Exons:
1
Description :
pol protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-172
*** None ***
PositionContextScore
52SNKRKHR|FI0.576
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        518 bases(100 bases per row)
ATGACATCAGCCCAAGACAAGCAAAACGAATACTCTGACACAAAAGGTAGAGAAAACTTAAACGTATATGACGTTGGGGAGTTAGTCCTACTAGACACTA
CGAATCTATCTCTAAAGCTGGTTAGCTCCGTAGGGAGTAACAAGCGGAAGCATCGCTTCATTGGACCCTTCGTGGTCCTAGGCAGGCATGGGGCCGCCTA
CACGATAGACTTACCAAAATCTATGGCGACCCACCCAACGTTCTACGTGAGCAGGCTCAAGCAGTATCATGATCCGCTGGGCCCTTCTCCTCAACAGGAG
GCAGAGGCCGTCCGTGAGGAGTTGAGCTCACCTCTTCAAACCGAGGTGGGGCAACCGGCACTGGAATTGCCGAAGCCGGTATGGGGAAAGGAGACTGATA
TCCCCGCGGATCGTACGCCGAGTACGCAGGGTTCCCATGCAAAGGACCCCCATAGGAGCCATACGCATAGGTTGGGTGATACCCTTTCTCGGGAGGGTGG
CCAGCTATGGACCTCCTG