Transcript Name :
Phyli_Pl_103646
Orientation:
(+)
Number of Exons:
2
Description :
myosin-like protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Myosin head, motor domain0PR00193
Profile scan predictionP-Valprediction_id
IQ motif, EF-hand binding site6.577PS50096
IQ motif, EF-hand binding site7.565PS50096
IQ motif, EF-hand binding site7.401PS50096
HmmSmart predictionP-Valprediction_id
Myosin head, motor domain0SM00242
IQ motif, EF-hand binding site0.089SM00015
IQ motif, EF-hand binding site1.7SM00015
IQ motif, EF-hand binding site0.31SM00015
IQ motif, EF-hand binding site20SM00015
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1364
*** None ***
PositionContextScore
714EAIRVSR|SA0.578
1346SIFRSGR|SN0.551
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein bindingGO:0005515IEA
motor activityGO:0003774IEA
myosin complexGO:0016459IEA
*** None ***
*** None ***
Sequence
        4184 bases(100 bases per row)
GTATACACGCCAGACACAGAGCATGTGTGGTTGCCTGGCGTGATCTGTGGTGCTAGTGGTGACGGCAAACAGCTCACGGTGCGACTGGATGAGGTCGTGG
GTCCCAAAGATGCGTCTGTGTTGGATCACATCCCTTCCGAGAATGAACTCAAGGCTTTTGCCGGCTCGCAACGTGCTGTGAATCTCACAGATCCGTCGGT
GCTAGAGGCACTAAACGCCAAGAACACGTCCGTGGAATCTGGAGACAACAAACCGTCGTTGCCATTGCAAAACACGAGTGAAAATGCAAATGGGTTCGAA
GATATGATCCTGATTGACCATTTGCATGAGGCGTCCATCCTGTACAACCTCAGAAGGAGATTTTTCCGCCGATTGCCATGTACGTTGATTGCAACTTTGC
CGTTTTTCACTTTTATGACTGACAATTATTGCCATTGTATTTCGTTCTTGAACAATAATTGTTTTCCAGATACATACACAGGACGCATCTGTATCGCCGT
GAACCCGTACCAATGGCTGGATTTATATTCCAAACAAACAATGGAGAAATTTAGCGATGGAAAACGGGACAACAAGCCTCCTCACGTTTACGCCGTGTCC
ATGGAAGCGTTTTTCAACATGAGACAGAAACAGGAAAACCAAAGTATTTTGGTGTCGGGAGAATCAGGTGCTGGCAAAACGGAGACCACCAAGATCGTCA
TGAGTCACTTGGCGGCTCTTGCCACGAACTCCAACTCCAAAGTTATCCAACAAATCATCCAGGCCAATCCATTGTTAGAATCTTTTGGAAATGCCAAGAC
CGTACGCAACGACAATTCCAGTCGTTTTGGTAAATTCACGGAACTTCAGTTTACCATTGAGGGGCAACTGATTGGTGCCAGATCCCGCACTTATTTGCTG
GAAAAGAGTCGCGTGACGACACAAGCTGATGGAGAACGCAATTTCCACATTTTCTATCAGTTGCTGGCGCAACGCAAACAATTTCCAGAACTGGCACTCG
ACATGGTAAACTCATTCAAGTACGTTTCGGTGCGAGCAGAAGCCCCCGGTGGGGACGAAGAAGGGTACTTGAGTCGTACAAGAGAAGCTCTGGAACTCGT
TGGGATTGAACAACCTTTGCAACTGGAAATTATCCAAATTTTGGGTGCCGTGTTGCATTTAGGTGAGACAGAATTCACAACTCGAAATGGCGATGTGGAC
GCTTCTCAGTTGGTGGATGTGAAACATTTCACTGTGGCTTGTCGTCTATTGGGTGTGGAGGTGGACGCACTCGAACGTGCCGTGTGCAATCGCAACGTTT
TTGTCGGTCGGGAAGTGATTCTCAAGCCGATGACGCAGGACCAGGCGGCAGATTGTCGTGATGCTTTGGCAAAAAGTCTCTACTCGAAATTGTTTTTGTG
GCTCGTGGAACAGATCAACGAGACGATCGGCGTTAAGACCAAAAGTGCTGGCTCGTTTATTGGAATTCTCGATATCTTTGGGTTTGAGCACTTTGAGACC
AATTCGTTCGAGCAATTCTGTATTAATTACGCCAATGAGAAATTGCAGCAGAAGTTCGTGCAGGACGTGCTCAAGACGGTGCAGATTGAGTACGAAGAAG
AGAATATTTCGTGGTCTCACATTACATTCTCAGACAACCAGGACGTGCTGAATCTCATCGAAGGCCGCTTGGGTGTCATCAGCTTCTTGAATGAAGAATC
GCTGCTTGCCACGGGCACGGACGCATCGTTTGCGAGCAAATTGGGTGCGGTGATGGAGAATAACCCGTTGCTGGAGACCCCTCGGCTAAACAAGTGCGCG
TTCTCCATCTACCATTACGCTGGGAAGGTCACCTACGACGCAACGGGCTTCCTCGACAAGCACCGCGACGCCATCTTGCCGGATATTAAGCAGTGCATGA
GCAAGTCCAAGCTCAAGATTTTGTCCAAAATGTTCACGGATGATGTAAATGCCAGTAGTGCTAGTAGCACTGTGTCTAGTGCTCGTGGCAGTGGCAGGAC
ACGCAGCAGCAGCTCAAAGAAGGGAGGCCACGCCCAGACACGCCGAACTACAGTCGGTACTCAGTTCAAAGAGAGTCTATCGCAACTTATGGAGAAGATC
AGTCTCACTGAGGTGCACTACGTGCGTTGTTTGAAACCAAACCCGCTCAAGAGTGCTAACTGCTTCTCACACGGCGATATTGTGAGCCAGTTGCGGTGCG
CCGGTGTCATTGAGGCCATCCGTGTGTCTCGCAGCGCCTACCCCAGTCGCATGCCGCACTTGGAGTGCATCAAGAAGTTCCGTGTGTTGCTTACAGGAGC
AGTTCCAACACAGAATAAGTTTATCAGTGACTCGGACACGGAGCATATCAAGAATCAGTGTGAAGAGTTGATGGAGAAGCTGTTGCCCGGGCGTAATATT
CAGGACTACCAGGTGGGTCTGACCCGTGTGTACTTCCGCGAAGGTGTTCTGGAGGAGTTGGAGACCAAGCGCGGCTGGGCTCTGCGCAAGTATGCTATCG
TGTTGCAGAAGAATGTGCGCTGCTGGCTTATGCGCCGGCGTTTCTTGCGAAAGAAGAAGCAAATTGTTGTCATCCAAAAGTACTGGCGTCGTTATGTGGT
TCACAAGCGCTACTTGACACTGCGTAGAGGTGTGGTGATTCTACAGGCTCAAGCACGTGGCGTTTCAGCTCGCAAGATGTACCGTGTGCTCAAGTTTGAC
TACTGCATCGTGCGTTTCCAGGCTTACTGTCGTATGCACACGGAGCGCCAGCGGTACCTGAAGAAATTGGCTGCTGTAAGAAGACTGCAAGGATTCTTCC
GTTTCTCGCTCTTGCGTCTCGTGTTCCTGCGTAAAATGGAGAAGGAGAAAGCGTACAAAGAGCTTGGTTCCAAGGTGGCACAGCTTCAAATGAAGCTGGA
CAGGAAGCAGGTGCACACTGGAGCGAAGATGTCCCCATCAGGGAAACATCGTTCTCTCAGCCCGTCAGATGTACCACACGCAGCAGGACCGGGCAGTGAC
CGCGGTACCAGCAGCAGTAGTTCGACCCGTGGATCGATGCTTAACAGTCGGTTCAGTGGTACTAGCGGCATTCTGGACGAGAGTCACGAAGTGATCACAG
CGCTCCACGAAGAGAACGAGAAGCTGCGTCAGCAGTTGGAGAAGCAGGAGTCTGAGATCCAGCGGCTGAAGACAGAAAACCGCACGCTCAAGAACTGGCA
GCAGTCCAAGGAGGTGGGCGAACAGGTGCAGAAGCTGGCTCACCGTGACCAGGAAAGCAAGGACCTGACGTACTTGGCTGCGATCGAGACTGAGTACGAG
AAACTCCGCTCGTACATTTGCGAGTCGCGCGAGTTGCCTACCGATGTTGGCAGCATCACTCAACCCAACAACGCTGTGCCTGCTTCTGGAGGTCGTGGTT
CGCTGACCTCGTTGTCGTCGGACAAGTCGCTGCTTGCCACAGCAGCGGCGAACGGCATCATGGACCAGAAGTCTGCTGAGGCGCACCACCTGCTGACGAA
GAGTGCCGCACGTATCGCCCATGCCAAGAGCAAGGTCTCAAGCAAGGGCAACGCGCGTCGGGTCAAAGACCACTGGGAGGAGATCCGCAATTACCCACCG
CCGATGCATTACAGTCTGGGTTCTGTGCCATGGAAGCGCTTGCTTACAGACTGGGCGCAGGGCAACCCGAAAAAGCTAGACTACATGACGCGGTGGCTCA
AGAACGTCTTGGACGGCGGTCCGATTGTGTCGGACACGTTCCCCATGGGTGTCGAGCTCAAATACGTGACCCCGATGATGCTGGATGGATTTATGCAGCT
TGTGATCCCGAAGCTTGCGGAGCGACCAGATATTCAGGTGCACGTTCACACGAAGGAATTTATTGGAACGAGCATGCGGATTACGCTGTCTCAGTTGGAG
CAACAGGGTAACCAGCGGTCTTCATTGGCACACCCTCGTGTAGAGCGCTCACCACCGTTGGAAGTCGAGGACTTTCAGCGTATTTCGATCCTCGCCAACT
CCAATAGTCGCAACTCAAGCAGCCGAATGTCCGCGTCAACGCTGAGTCTGTCGCCGATGGAATCGAGCTCAGCCATGTCGTCTGGCAGCCCGAGCAGCTA
CCGCTCCAGTATTTTCCGCTCCGGTCGCAGCAACCACAACAGCGACCACAACCCGCGCAATTCGTTCTTCCATCGGAACAAGTA