Transcript Name :
Phyli_Pl_111626
Orientation:
(-)
Number of Exons:
2
Description :
WD domain-containing protein, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
WD40-repeat-containing domain14.476PS50294
WD40 repeat15.688PS50082
HmmSmart predictionP-Valprediction_id
WD40 repeat60SM00320
WD40 repeat4.7SM00320
WD40 repeat9.8SM00320
WD40 repeat190SM00320
WD40 repeat0.00000000011SM00320
WD40 repeat400SM00320
WD40 repeat0.0036SM00320
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1012
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        3152 bases(100 bases per row)
TGAACTCGTTACTAGGGTACTCGAAAGGTTTTGTTTGTGGTGGCTCTGGCGGATGTGTGCGCATTTATGACCGAAACGATGACGGAGGGTCACGCGAGTA
TTACAAGAAGGCAAAGACTTTTCGAATCGAAGGCGATACCAGCACGATCAAGGATCTGGCCATCAGTCCGAGTGAAGACTTGCTCGTTTGTTCGCTTGAA
AACAACCAGATGTATGCACTCACACTCTCAAGCACTGATATTCTCAAGGAAGATGCCATGAATTTCGAGCTCGTCTCGACCGCATTTCATGCACCAAGTA
GCAATGGAAGCTGTCATATCACCGGGCTTGATACGTGCGTCCGCAAGCCGCTAGTAGTCACTTGTGCACTTGATCGATCTGTGCGTGTGTGGAATTACTT
AGACAAGTCAACAGATATCCTCAAGTTCTTCCGTGAAGACGCATTGTGCGTGGCTTTTCATCCGTCGGGTTTGCACGTTGTTGTGGGTTTTACCGACAAG
CTACGAATGCTTAACGTCCTCATGGATGACATTCGCTCTTGTCGTGAATTTTCCATCAAAGGTTGTCGTGAGGTTCGATTCTCACACGGAGGTCAGTTTT
TCGCTGCGGCCAACAGTAATGTCGTTCATGTGTATGCTACCTACACTGGCGAGCTAGTAGCTGTACTGCGCGGACATTCCAATCGTGTGACGTCAATATC
ATGGAAGCCTGACGACCGGAAATTACTCTCATGCGGTGCTGATGGCACTGTCCTGTTGTGGAGCCTACGTGGAGCATCTAAAGTTGGTGATGGTCATTCA
CAGGCTCGCTGTTCGTACATTGATGCTGCATTATCCCCAGAAGGAGATGTGGTTTACGCCACAGGTTCAGATAATATGCTGAAAGAGATTGATATGGCCA
CGGGTCTTGCAAGGGCCGAACATTGGACTGGCAATAATGGGGTTACTTTGGGCCCGCTAGCCCTCGCTAATTCTCAACAAGTACTTTTCGTTGGATCAGC
AGAACCAGGTCGTCCTGGTATGGTGAGGTTATACCGTTTGCCATTGGAGAAAGATCACCAGCCACCTGCATCTGGATTATTGAGCGGTGTACAGTCATCT
ACTTCACCAGGCTCTATCTTGCCCACAGGCCAAACTGGATTAGCAGTAGTATCTGCTACAACGGGGGCAAGTTCAGTATCCCAATCTTACACCGAATATC
ATTGTCATGATCTCCCGGTGTCACGACTTCGGCTATCGTTTGACAACCAGTTTTTATTTTCTGCAGGTGAAGATGGCTCGTTATGCATCTTTGAGACGCA
GAATGTTATTGGAAAAGGAAGTGGAAGTAGTGCTAGTAGTGGCCCAGGGAGTGGAGCAGTTGGAACTAGAGAAACACGAAGCGATAGTGCAATGCTTAGT
GGCGGCGGTGGTGCGAGTGGCTCAGGTTTACCCTTCGCAGAGGAAATTCTGGTGACCAAATCGGATTTGGAAGAGAAGAATCGTCTCATGAACGAACTCA
AGTCGAAGGTAGACGAGCTAACACTTCACAACGAATACCAACTTCGGTTAAAGGATCTCAACTACAAGGAGAAGATTAAAGAGGTCTCAGATAAGTTCAC
AGCCGAGTTAACGCAAGATAAGCAACGCTGTGGTGACTTGCAGAATGACAAAAACGAAATGGAAAATGAGTATCAAAAGAAGATGCGTGAAATGGCTTCG
ACGCACCGCAGTGAAGTCCAGGAGCTCAAAACCACGTACGAAGCAAAAGTGGAGGCAGAAAAGGCACGCTATGCAGCTCTCGAACAAGCACGTGGCGAAC
AAAACACACGGTTTGAAGAGGAAAATCATCTACTCGTCGAGAGCCACACGCAATTTCTAGCAGAGATGACAACAGAATACGATCAAAAAGTTGCCCACGA
GCAGGAACTACAGGGTGTCTGTGCAAGAGCCAAAGACGAACTAATCGCAACGAATGAGGCGCTCAAACGTGCTCTTGAAGAGGATGCGGAACTGGAAGTG
GAGGAGTTGAAGACCAAGTATGAACTGAAACTGTCAGACGAACGTGAGGCAACGCTACGCCTCAAAGGTGAAAATGGGATCATGAAGAAAAAGTTTTCTG
CACTCCAAAAGGATATCGAGGATCAACGCGAGGAAATACGATCACTAGAAGAGAAGGGGAAAGAGCTGACGGAGAACATCCGTGGCTTAGAAAAGGATAT
TCAGGGACACAAGAAGGAGATCAGAGAGCGTGAGGAGACTATCCAAGACAAGGAAAAGCGTATCTACGACCTGAAAAAGAAGAACCAAGAGTTAGAAAAG
TTCAAGTTCGTTTTGGACTACAAGATCAAGGAGTTGAAGCGTCAGATTGAGCCACGCGAGCAAGAGATCGCTGATATGAAGACGCAAATTGAAGAGATGG
ACGCTGAGTTAGAGCAGTATCACAAGAGTAATGCTGCGCTAGACCTCATGATTGGCGAGTTGCGGCTCAAGATGGACGGTATGCAAAAGGAACTGAACTT
ACAAGCTGCACAAGTAGCTTTAGGCAAGGCGTTAGTACGGCAGGTGCAATCTGATTTGCTGGGCTGTGCTCAGCTTCTGGACAACAAGAAGGCCCTTAAG
GTTGCTGTCATGGCGCTGAACAAAAAGTACGAGGACGGTGTCACGCATGACGCGAAAGAGCCCGACTCGCAGGCCGAGTATAATCGCCAACGCGAATATC
TTGAGAAGGAAGTCGAGTCCTTGAAGCGGAAAATCATGAAGGGGATGGCCATCAGTGAGAGTGAGCTTCATCGGTTACAGCGCGAAAACGCAATACTAAC
CACGCAGGTGAACGAGTTGCGTCGCGAGTTTCATAATGTGCGTATGCAGACGCAGGAGGTGCGCGAAACCAAGTACAAGTCGACCATATTGATTGCAAAC
AGTGCAGCAAGCAAGAAGCTATCAGTCAGTAGTGAGGTGATACGTGAGCGCAAGGAGAAAATACGCGAGGCTGAGTTCCAGAAAGAGCACATCCTACAGC
TCAAGGCTCGCCTCACTGAGCTGCACAAGGCTCTTGGTGGGGGTCTCAAGTTTGCACTGACAGGATCCAACAACTCGCCTCAATACAGGCAACAGCAACA
ACAGTACATCAGAAAACCCACTCCACCGACGCAGCGACTTCCACCTGTATAA