Transcript Name :
Phyli_Pl_110243
Orientation:
(+)
Number of Exons:
1
Description :
copper-transporting ATPase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Heavy metal-associated domain, HMA0.000000000079PR00942
Heavy metal-associated domain, HMA0.000000000079PR00942
Heavy metal-associated domain, HMA0.000000000079PR00942
Heavy metal-associated domain, HMA0.000000000079PR00942
Heavy metal-associated domain, HMA0.000000000079PR00942
Heavy metal-associated domain, HMA0.000000000079PR00942
Cation-transporting P-type ATPase4.3e-25PR00119
Cation-transporting P-type ATPase4.3e-25PR00119
Cation-transporting P-type ATPase4.3e-25PR00119
Cation-transporting P-type ATPase4.3e-25PR00119
Cation-transporting P-type ATPase4.3e-25PR00119
Cation-transporting P-type ATPase4.3e-25PR00119
Profile scan predictionP-Valprediction_id
Heavy metal-associated domain, HMA9.186PS50846
Heavy metal-associated domain, HMA13.066PS50846
Heavy metal-associated domain, HMA12.496PS50846
Heavy metal-associated domain, HMA13.525PS50846
Heavy metal-associated domain, HMA14.445PS50846
Heavy metal-associated domain, HMA21.524PS50846
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-659
660-677
678-686
687-709
710-729
730-752
753-766
767-784
785-927
928-950
951-964
965-987
988-1286
1287-1309
1310-1312
1313-1335
1336-1373
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
metal ion bindingGO:0046872IEA
integral component of membraneGO:0016021IEA
metal ion transportGO:0030001IEA
cation transportGO:0006812IEA
*** None ***
*** None ***
Sequence
        4121 bases(100 bases per row)
ATGGTGGTGAGCGAGGACCACCAAGAGTTGCTGCCACTCGTGCGCGGCGTCCAGGACGGCGCTTGTGTGCCCGCGGCCGAAGATGTGCCCAGCGTGACGT
CCTCCCAGCGCCGCGACGACGAGGACTGCGTGGTGTTCCTCGTAGTTCCTGGCCTGGCAGACGACCACGACGTCGTCAGGATCGAAGCGGCGCTCAAGCG
CAGCGCATTGGGCGTGCGCAGCGTGCAGCTGGATCTGCTGGAGAAGCTGGCGAGGATCGAGCTGTCGCACCGCGCGGACGAGGCGATGGAAGCGGCGCTG
GCTGCAGAGCTGCGACGCGCTACACCCGCTCAACTGGTGGCCTACCCAGTGTGGCAGCACCGCGAGCGCATCGTGCGTTTGCGCGTGGATGGTATGCGCT
GCATGACCAACTGTGGGCGTCAAGTGATCCGCGCGCTGGAGCAGATCCCCGGTGTACTGCATATTCATGTGGATTCCAAGTCTAAGACGGCGGAGGTGGC
GTTGGCTAAAGGCTGCACAGCTACAGAGGTGGACCTCATCAAATACATTCGCGCAGCCAATCCACGCTTTGATGCGTCGATTGCAAAGGAGAAAAGGGCG
CGCACGAACTCTGTGCCTGGTGCGATCTTGCTGAATATCACTGGCATGAGTTGTGCTAAGAACTGCGCATCGAAGGTTCAAGCCGCACTACAGAGTGCTG
ACGAGGTGATTGACGCTACAGTTGATTTTGGCAACAAGCGCGCAACGATTATCCTTGAGCCAGAAAGTAGAGTGACGGAGGAAGATTTGATTCAGGTGGT
GCGCGGTGTTGGCACAAAATTCGATGCGTCACGCTATGAACTGTTCAGCAATGATGGAGACTCTCGTGTAGTATATCTCAAGATCGATGGTATGAGTTGC
GCGAAGAACTGCGCGAGGAAGGTACAGGATGCGTTGAATGGCGCAGATGGAGTTATCAACGCCAAGGTGGACTTCGATACGAGCCGCGCTACTATTTTCT
TGGAGATGGGTAGTCACTTGACGGAAACTGACCTGATTAATGTCGTGCACTCTGCTGGTCAAAAATTTACAGCTTCTGTAGCAATGCCAACGAGTGGACC
GAGATCAATTCTTCTCACCATTGAGGGCATGAGCTGTGCGAAAAACTGCGCAAGTAAGATTGAAAAGGCTTTGAATGCAGTGACGAGTGTGGAAAGCGCA
ACGGTGGACTTCCCGCTTAAGCGTGCCATTGTGCAGCTTGAAGCTGGTAGCTCGCTAACGGAGAACGATCTAATCGAAGTTGTTCGCGGTGCAGGCGCCA
AGTTTGATGCTACGGTGTACGTTCCGTCACTTAGTCCACGCACTGTATTGCTTGAAATCGACGGTATGAGCTGTGCTAAAAATTGCGCACGTAAGGTGCA
GCAAGCTCTCAGTGGGACGGACGGTGTTGTGTCGGCATCTGTGGATTTCTTAGCAAAGAGGGCAACTGTTGAAGTGGACCCTGATGGATATTTTAACGAC
GAAGAACTGCTGGAAGTTGTTCGAAGTGCTGGGTCTAAGTTTCGCGCTCGTCTCATCAAGTCAACAGTAGAGACAGTGCCCGATGTTACAGAGAAGACCG
CAGAAACGAATGCAGTTGAATTGCAAACAAAGTCGGAGGTATCTTCGACTGCTACATCGGATGATGTTGCAATATCTATCGACTCTGACAAGACCGAGAT
TGGAGAGGCAACGCTTCTAGTTGGTGGGATGACTTGTACGTCGTGCTCCAACTCAGTTGAAAACGCGCTGAAGCAAACAGAAGGTGTCATATCTGCTGTT
GTGACTTTTGCGACGGAAAAAGCCACGATTCGCTTTGATAAAGACATCATTGGGATCCGAACACTCGTTGAGACGGTTGAAGATATCGGGTATGACGCAA
CGTATGTATCGGGCGCAGAAGCACAGAAAGCACTTGGAGACCAGCGCGCAAAGGAAATCACTCGGTATCGTGTTGACTTCTTTGTCTCGGTACTTTTCAC
ATTCCCGATTCTCCTAATCATGATGGTGTTTGACAACATCGCACCAATTGAGCACGGTTTAGCTTCGATCATACTTCCGGGTATTTCGTGGCAGACATTG
ATTGTGGCGATTCTAGCCACACCAGTCCAGTTTTACCCTGCACGTCGATTCCATGTCGATGCTTGGAAAGGGATGAAGAACCGGATACTAGGCATGTCGT
TCTTGGTGTCTATGGGTGCCAATGCCTCGTATTTCTACGGTCTCTTCAGCATTATTCGTGCATTCTTGCTGAACAATTCAAGTGTCGCCAACCCAGACAT
GTTTATGACGTCGTCGATGCTGATTTCGTTCGTGATTCTGGGAAAATTTCTGGAATCGATCGCAAAGGGCAAGACATCGGCAGCATTAAGCAAGCTGATG
GAATTGCAGGTCAAATCGGCGACACTATTGGTTTTCAGCGCAGATGGAACTAGAATCCGAGAGGAACGGACAGTGCCAATTGAACTGGTCCAGCGTGGAG
ATATCCTGAAGGCAGTTCGTGGATCATCAATTCCGGCTGATGGTGTCATCGTGTACGGCGAAGGTCGCATCGATGAATCGATGCTGACAGGCGAATCCAA
GACAATCAAGAAAGTCACCGGTGATCGTGTGTTAGGTGCGACCGTCAACGTCGACGGGTTGTTCCACATGAAGGTTACTGGTGTGGACAATGACACTGCA
CTAAGCCAGATCATTCGTCTTGTGGAAGACGCACAGTCATCAAAAGCGCCAATTCAAGCTTACGCCGACTACGTTGCCTCTGTCTTTGTCCCGACGGTGC
TAGGACTGTCGTTCTTGACATTCTCGGCGTGGTACATCCTTTGCATCTTCGAGGTTGTTCCAGAAAGCTGGATCCCGCACACGGACAGCACATTTGTGTT
CGCTTTTAACTTCGGCATTGCGACGCTCGTAGTGGCTTGCCCATGTGCGTTGGGGTTGGCGACGCCTACCGCTGTTATGGTTGGAACTGGCGTCGGCGCT
GAACATGGTGTACTGATCAAGGGTGGTGAGCCGCTGCAAGCTGCACATAACGTCAACACGATTTTGTTCGACAAGACGGGAACCCTTACTGTGGGGAAGC
CTGTGGTGACAGATGTGGTGGTGCTCAGTAAGAAGCTTACCACCGAGGAGCTGATTATTCTTGCTGGATCGGCTGAACTTGGTAGCGAGCACCCGCTGAG
TAAGGCGATCATCGAATACGCGAAATTCATCTCGTCATCTCTCGAGCAGCCAACAGGCTTCCGCGGGGTTTCTGGACGAGGCATTGCGTGCATGGTCGGT
GAACACAAGGTGGTGATCGGGAACAGGGAGTGGATGGCAGATAATGGCTTGAAGCGTTTGACCAGTATTGTGCTGCAACAGGCCACGGTGACTTTCCAAA
ATGCTGGAAAGACAACGATTTACATGGGCGTCGACGATGAGCTCAGTGCCGTCTTTGGTGTGGCAGACGCTCCTCGCAAGGAATCGATTCGTACGCTGAA
GAAGCTAAAACAAATGGGTCTGGACGTTTGGATGGTCACTGGAGATAACGCACGTACTGCTTTCACCATTGCTGATCAACTTGGAATCAGTCGTCGTAAC
GTCATGGCCGAAGTGGTCCCTTCCCAAAAGTCTTCAAAGGTCAAGCAGCTCCAGAGCACTGGTCGCATCGTCGCCATGGTGGGCGACGGCATCAATGACT
CGCCTGCTCTAGCGCAAGCAGATCTAGGTATCGCGATTGGCGGTGGCACTGAGATCGCCGTGGAAACAGCAGGTATGGTTCTCATGAAAGCCAATTTGTT
CGACGTTATCACAGCTCTAGACTTGTCCCGAACGATCTTCAACCGCATCCGCCTGAACTACGTGTGGGCTTTAGGCTACAACTGCCTGCTGATCCCGTTG
GCTGCTGGTGTGCTGTACCCCTTCGGTTTCAGCATTCCGCCCATGTTTGCAGGTGGAGCTATGGCCATCTCGTCCGTGTCGGTGGTCACCTCTTCACTCT
TACTTCGACATTACACTCCTCCAGCTCTCCCCGAGCACTTTAGCGTGGATGATACCAAGTCACTGCTCTTCAAGAAGCCGACGGTCACCACGCCGCTACT
CGCCTCTAGTACACTGGAATA