Transcript Name :
Phyli_Pl_101942
Orientation:
(-)
Number of Exons:
1
Description :
Amino Acid/Auxin Permease (AAAP) Family
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-40
41-63
64-77
78-95
96-101
102-124
125-138
139-161
162-173
174-196
197-226
227-249
250-321
322-340
341-349
350-369
370-381
382-401
402-437
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1313 bases(100 bases per row)
TGGGTTTCGCCAACATTTGCTCGTGCGTGGCTATTTCGCGCGTCATGCTAGCAGCCCCCAAGACTGTCAAGACCTACGGTGACGTCGGTGAGTGGTGCTG
CGGTCCGATTGGTCGCTACCTCGTGCTCTTCGTCCAGTTCGGCGTATGCTGCTTGGTGCCGACCGCATTCCTGGTGCTTGGTGGAATCCTGCTTGATGGT
ATCTCCCCTGATGCATTCGACCAACAATACTGGAGTATTATCATGGCTGCGATGCTGTTGCCTGTGATTCTTACTCCAACTCTCAAGGAGGGTGCTGCTG
CTGCCTTTGCTGGTTGCCTCGGCACGCTTCTTGCTGATGCCATCGCTCTCGGTGTGCTGGTGAACGGCATCGGTTCGGACCACCCGTCCGTGATTACCCC
CGACTTCGACTTTGGCCAGGCCGCGAGTTCGTTCGGTAACCTGGCATTGGCCTACTCAGCCGCTGTACTGGTGCCTGCTCTGCAGCGTGAGCACTCACAG
CCTGAGCGCATGCCCCGTGTTGTTGCTACGACCATGATCTTCACGGCTTGCCTCTTCCTCATCATCGGTGCGACGTCGTACTCTTTCGTTGGGTGTCAGA
TTCCGGGAAACCTCCTCTTCGCTATCGGTGGCACGGCGCTCGACTTGAATGCCAACCGCGGTGCTGTTGTGCTTGCATACATGTTCATGCAACTGCACAT
CACCATCGCTATGTCCGTGATCCTGAATCCCGTGCTGTACATTGCTGAGCGCGGCATTCTGGGCATGCACAAACGTCCAAACCTTCCTATTGCTGATGAA
GAGTCCCCGGCGTTCGAAGTGATCAACACACCTTCGCAACCTAAGGACCGTGCCTCTGTGGTGGGCCCATCTGTCACGTCGCTGGCTGACGCCGAGTACG
ATCTGTCCCCAGAGGCTCTGATCGACGAGTACCACAACAGCGGACCTCTTGTCACCGCCAAGTACATTACGCTCCGCATTGTCATCGTCGTGACTCTCCT
CATCATCTCCATCATTTTCAAGGACCACTTCGTCGACTTTACGGATTTCGTCGGTGCTTGGGCTGTGTCGATGGCTTGCATCATCCTACCAATCTTCTTC
TACCTCAAGGTGTTCTGGAACCGCACTCCTTGGTACGAGAAGGCCATCGGTTCATTTATCATCGTCGTCTGCGCTGGCCTTGGTGGGTACGTAACGTACA
CGACAGGTAAGAACCTGTTCCTCGACATCGTTAGCGACAAGACATTCCCCTACTGTCCGTCGGGCTACGACATGGTCGTGTACACGAACGAGACCTTTTA
CGGCAACAACTAG