Transcript Name :
Phypl_g10138
Orientation:
(+)
Number of Exons:
12
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.0950.055130
InsideOutsideTMhelix
1-1379
*** None ***
PositionContextScore
216LERRRKR|MT0.602
TypeScore
nuclear47.8
GO
*** None ***
*** None ***
*** None ***
Sequence
        5514 bases(100 bases per row)
ATGGCCACGCGTACAGGAAGACTCGTTGTTGACCCGCGGACGGGAAAGATGGTGGACGAGTACAAGGAGGACCAAATGGCTGTGGCGCTCTTCAATCCGG
AGTGTTCCAAACCCGAGGACTACCAGTTCCGTTTCATCTTGAGATCCGACTTCACAGTGTACGTTAAAAACTAGAAGTACTTCTCTTACTTGGTCGCTTG
CTAACGTTTCTTCTCACAATCAGCCCCAAGATCAACCTGCTCTTCGAGTGCAATGCTGCTTTGCTGAAGGATCCATTCGGCAGTACGTTTCTCCACCTCA
ACAAGTTCAATTACTAGAAAACTAACGACTGGTATTATAGATGTACTATGGCCCAAGGACTGGATGACGCAGGTGCTTCCGCCCACAGGCAGCGATCGAT
GGTACTACATCATCCACGAGCGCGTGGAGCCAAAGCCACAGGACGATCTCCAAGACCCTTTCTACACTGGCGGGGCGCTTTTGGTCCTCGCCTTCGTGCC
TGCCCAGTGCGAGCCGATTGACATCAGGACGTGGTTGCTCTTTGGAATCTCCCAGGAATTCCAACCTCTGCTCCGATTGAAGCCACTGGTTGCCACTGCT
CGAAAGAAGCTCAAGGTTTTGAAGGAGAAGATCAACGCTCTTCCTGTTACGGACTTGGCGGGGACCCAGCAACAGCAGACGGAGACTCGAAAGAACTTGG
CGGACGCGATGAGCGCTCAATCGAAGGAATTAACAGACGAAATCAATGAATTGGAGCGCAGACGGAAGCGGATGACGAAGCTGATCATGACGGAGCCCAT
AGCACTCGCAGAAGTCCCTCGAGACGCTGAGCTCCCATCGACTAGTATGAAAGATGAAGTGGAGGTGAAGACTTGGGCTGCGACGTTCACGAGTCCACGT
GGACGAGGTCTTGTATCGATTGCGTTGGAGAAGAACGACTGGAACTACGTTTGTCTAGTGCAAACACGGCCACAACCGAGGGCCTTTTTCGAGGATGATC
AGCTGTCGAATCAAACAATCGATCCGGATGATCTTCTGAAGGAAATCAACATGCGAACGGTGAGACTTCGACGCTTACGTCATGGGGAGGGCGAGTTGAT
GGCTCCTACTGCTGCAGCTCTAGCCGCTGATGAAGACGAAGTGTCGTTAGATCCAGTGGACGAGCGTTTCCACTTTTCATCTATTGGTGGCGTGTACTCG
GGAGCTTTTCGACTGGGAAAGAAACAAGGACAAGGCCAGGAGTACACGAACGTTGGGGTGTACGATGGCTACTTCAGTGGCAACACACGCTGCGGGAGTG
GCAAACTCGTCTACGGGAAGGGAGCAACGTGTGAAGGCACTTTCGACCGTCCACAGCGTCGATACGAATACAGTGACAAGCTACGAGGGCGAGCGTACGG
ATGTTCGTTACTGAATGGAGACGACTACCGAGATGGAGTGGAAAGTGGCGAAGGAATGCACTTAACGTTCCCAGATGGAGCCACCTACGATGGAGAGATG
AGAGATGGCGTTGTTTCTGGACTCGGACGATACGTGAGCTCAACTGGTGTGGTAGACGAAGGGATTTTCGTTAATGGAGTTCTTCATGGACCAGCTTGCA
AGCGAACGTTTCCAGATGGGTCCTTCGTTGAAGGACCATTCGTCGAGGGTCAACCGCATGGCCGTGGACGACAACGTGAGCGACACGGAGATGAATACGA
AGGTTTTTTCGATGGTGGAGCAAGACACGGGCGTGGTGTGGCTCGGTTTGAAGGTGGACGATCGAAGCACGTGGGTTTCTGGCATGAAGATGCTATGGAT
GGTCGAGGGGATTTTTACTATCGTCTCGGTGATAATATCACTACTGATGATGAACTTGCTGGTGATACTGGGGAGGATAAAAAGAAGTGGGAGTTTTGGT
ACGAAGGCGCGTTCATGCAGAACGAAACTCGCGCTCGACATCGCCACGAAGATCTTCGACCGCATCAGCAGCGCGAATCATCGGAGCGCCATTTACCCTT
CACGACCAACGGTAAAAGCCGTGAGAAGATGCCGTTCCTGGTGACTGAGCTCCCCACGCAACTGGACAAGCTCCGACGGCGCAAACAAGCGAACGGAAAG
CGACGCACAGAGCGAGAAAGGGTTTATCTGGAGCAGCGCGAGTTGGCAAACCTCACGATGTACTACGCGCTGCTGGACGATTTCTATGAGCAATGGACGA
AACGGAAGTGCGAGGAGCACGAAGACACGTTGCTGGATAGCGAGGAGCTGCGTCGTGTTCAGGAAGAACGTGAGGCTTTACGAGCATTCGAAGAGCAACG
GGCGAAATTCCGGAAGGAGAAGTACAACTTGTCGCCTCGTAAAAAATCTCTTGCGAAATTCGAACAGCACCTCGAACGAGTGACGCTGACCGAGCAGGTG
AGGCTGAAGAGAGCAGAAGATGCCGATGGGGCCGATATATATAAAGTAAAAAAATTAGGCTAGACAAACAAAAGTATCTTTGAATCTGCGACGTGTGAGC
AGATGGATACATTACGTATACGTAGTGTACAGCCATTTGATTCCTGCCATTTTATCCGGCAATTATCCGCCAAGGTGACGCTCGAGCATGTCGAACATCT
ACATCACCGAGCCTAACACGGAGGGCAAGGTGCTGTTGCACACGAGCTTTGGGGACCTGGACGTGGAGCTGTGGCCACAGCAGGCGCCCAAGGCGTGTCG
TAACTTTGTGCAGCTCTGTCTGGAAGGGGTACGATTATCTCGCTTCATGTGTGGGATATGACGTTTTTTGCTCATATGATTTATTGTTCATATGATATGA
TATGACAGTACTATGACCAAACGATTTTCCACCGCATCATAGCTGGCTTCATGGTGCAAGGTGGAGACCCCACGGGCACAGGAAACGGAGGAGAGAGCAT
CTACGGAGGTGCATTCATCGACGAGTTTCACTCGAGACTGAAATTTAACCATCGAGGACTTTTGGCCATGGCCAACGAGAACAAACCGAACACAAACCAC
TCGCAGTTTTTCTTCACTTTGGACGCCTGCGATTTCCTCAACAAGAAGCACACCATCTTTGGCAAGGTAAATGTTGACTAGGTGTGTGGGGTATGTGCTG
CGTTGTTTAACTGTAAACTTTTTTGTATTTTGAATATCTGTTTTTAGGTTACGGGTAACACGATTTTCAATTTGCTGAGTGTGGGAGACCTGGAGACCGA
CGCACAGGACCGGCCTGCTAATCCACCGAAGTTGTTGAGTGTCGAAGTGCTGTGGAATCCGTTCGAGGATATTGTGCCGAGGTAAGAGAGATGCCGTTGA
CATTCTTTTGAAGTCGTATTTTAACACTCTTTATTCAATCGACAGAGCTGTCAAGAGAGACGATGTGCCAGAAGAGGGCGCTAAGAAGAAGAAACGTAAA
GCTACAGAAGACTTGAAGTTGCTGTCATTCGGAGACGAAGAAGAGGCCTTTCAGGACGAGATTGGTGGTGTGGCGAAGAAATCTAAAAAGAAAAAATCCA
AGACGATGATGAGCAGCCACGACCTACTGGACGACTGCAAGCTCAAGGCGGAGGTGGATACAGAGGTGCTACAAAGGATGACGAAGACAAGGGGCGAGGC
GGCCAGTGAAGAGAAGAAAGAGCGATCAAAAGCCAATCTGAAAGCAGCAGTAGCAGCTGCGAGCAAATCCACTCAGGCAGCAGCAGAAGCATCGAAGACG
GAATTGAGTGCCGTCAAGGATGAGAACTTCGCTACTGCTTCGAGTAGTAAGAAGAAGGACCGTGAAGAGTACGCAAAACTACGCGAGGAGCTGCGGAAAT
CCAAAAAGGCAGTTCCACTGCTGATGGGTGAAGAAGCGAAGAAGCTGGAGAAAGATCGAGCTTTCCAGGATATGCTGACTCCGTTGCAGCAACAGCGGCA
GAAGTATCTGCAGCGAAAGAAGGCCAACAACCGCACTGCACGTGAGCAAGATACTCTGTCGAAGCTGAAGAAGTTCCAAAGCGCGCTGTTCGACGTGAAT
ACGAAGAAGACGAGTCCTGCGGAAGGTGCAAACTCTGACGAGGATGCAGACAAGAAGGAGAGCGCTGAGAGTTACCACGGACAGATTCTGGAAGAGGATG
AGGACAAGGATGATACGAACGACGACAATTCTTGGATGACGGCCAAGCTCAAATTCAAGAAGCACATCGATGTAAGTATCTACGATTGGCAAGTGACACA
CGTTGGACTGACCAGCGTGTTATGACTGCTACAGGACCAATTCCGTGCCGGCAACGAGCCTTCAGCTGACGTAAGTTGAATTTGCACGCACAGCTGATAT
TCTATTTCAATTAACTTTATGTGGACACCTTTGTAACTTCAGGACTACTTGACAATCGACTCGCGCAACGAAAAGACCCACGGCTCCCGTGGAGAAACCA
GCAGAAGTGGAGACTCTCGTCGAAATCGATCGCGAGACAGAAATCGCCAGGGCCGTCGAGACTACGAGCGCAGAGATCGCCGTAGCGAAGACCGTCATCA
CCGCCGGCGGTAAAATGTAGCAGTCGAGAGAGAAGAAATTATACTTCATCGAAGCAAAAGTATAAAATTTCCTGTTGAAGCTACATTGAAGCTACTGAAG
CTGCTCCACTCATCAAGTATGACATGTCGTGGCAACACTTCATTGGGTCCTGCACAGTCTCCGAATCCTTTGCTTCATAACTCAAATCCCCCTGACAAGT
GCACATCAACCCAACAAACGGGAGTTATGACAACTAACGTCAAGGCGATAGATGGCTTCTTTACCAAAATCCCCCAAAGTGAAGCTCTGCCGGCGTCTCC
GCAGCTTTTCCACCAATTCAAGCTGGCAACTTCATCCTGGACGGAGTTTAAGCAGAACGTCGAGGAACTCACCAAAGCCGGTAAAAACCTCAAAGTGGTT
TTCTTCGTGCGTCACGGCGAAGGACTCCACAACGAAGCGATCAAGTTGTACGGGTCTGAGCACTGGTACAAGGAGTTGGTGACCAGCGATGTCTATAGAG
ACGCAGAGTTAACACCGTTCGGAATCCAAGACGCACAGACCAAGGGACCTCCAAGGATCAGGACGGAACTCCAGAGAGGAATGCCACCCATTGAGAGAGT
CATCGTCTCTCCGATCTCACGAGCCATTCAGACAGCTCAGCATTTCTTCGCAAAGGGCCAGACACCTGACGCCCCGTTCGTTTGTATGGAAGGCTGTCGC
GAGCACCTCGGAGTGGACACGTGCAACAACCGGCGGTCCGTGTCGGAGCTGAAGATTAAATTCCCAAACGTCGACTTTTCGGTCCTGACGGATGAGGAGG
ACGCTCTGTGGACGACTGACCACCGAGAATCGACTGATGAAATCCAAACGCGTGCGAAGGAGTTTCTGGCGGAGCTCTTCCGAACGATTCCCGAACGTCA
CGTAGCTGTGGTGACGCATTTCGGATTCATCGAGGAAGTTTGTGCGGTGACGATGGGGGTGAAGATTGAAGCGGGGAAGTGCGAGGTAGTCCCGATGGTC
CTGGAGAAGCTTTA