Transcript Name :
Phypl_g6930
Orientation:
(+)
Number of Exons:
3
Description :
hypothetical protein PHYSODRAFT_262200
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Integrase, catalytic core21.791PS50994
Integrase, catalytic core21.791PS50994
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.210.19437
InsideOutsideTMhelix
1-502
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
DNA integrationGO:0015074IEA
*** None ***
*** None ***
Sequence
        1836 bases(100 bases per row)
ATGATGCCCGCTGAGAATAATTATCCCGTCCACGACAAGGATCTCCTCGCGATGCGCTACGCTCTGATTAAATTCAGAGTGTACCTCCTCGGAAAGCAGA
CGTTCGCGGTCTATACGGGCCACGCCTCCCTGCGAACCGCGATTAAGAGCCCACATCTGTCCCAGCGGATGGCGCGGTGGTTGTCCTTCTTTGCCGAGTA
TAACTTCGTAGTCCATTACAACCCCGGCAAGAATAACATTCTTGTCGACGCGCTATCACGCCGTCCGGACTACGACCCACGCCGCGACGTTGGTCCTCAG
GTACCTGATGACGAAGACGAAGATGAATGTGCTTGCTGCGTCGCGTTGGGTTTGAACGCGACGGTATCGATTCCAGCGTCACCACTACGTCAGCTGATTG
CTGAAGCATACGACGCTGACTCCTTCCACGCCGACATCATTGCGCACCTCCGGAAACCCTGCGCCGAGTCGTTGAAGAAGTTGACGCGTCCGACACGCGA
CCAAATCGCGCGCTACCAGCTTGATGGATCTCTGCTGACGTATACGATGGACACTTTCGACGCTCCGCGAGTCGTCATTCCTGCCGATGACGACCTTCGA
GCGCGCCTGGTTCATGAGTACCATGACTCTCCTGTTGGCGGACATCTCGGTCGCGAGAAGACATTCGCCGCGCTCTCCCGAGATTGTTACTGGCCTCGGA
TGTACAAGTCGATACGGAAGTGGATCCGATCTTGCGAGACCTGTCAGCGCGTGAAGCCCTCTCCATCGTCGCAAGCTCCTTTGCGGCCGCTTCCCATTCC
TGCAGAAGCGTGGCGACCTGTCAGCATGGACTTCGTCTTCGGTCTACCGCCAGACAGCCAGGGCCGCACTGGTGCCCTGGTGCTCGTCGATCGCTTCAGC
AAAATGGTCCACTTTGCTGCTGTCGCCGCCCAAGTTACCGCTGAGGAAACGGCCAGTCTGTTCCTCGAACTTGTATTCCGGCACCATGGCCTGCCGGAAT
CTATCGTGTCCGACCGTGATCCCCGCTTTACTTCCGCGTTCTGGGACCGCCTCTTGAAGCTTCTTGGTACGCGCCTCCTCATGTCAACGGCGGCCCATCC
AGAGGCGGATGGGCAAACGGAGCGTGTGAACCGAGTCCTCGAAGACGTGCTGCGCAGCTACGCGACAGCGTTCGAGTCATGGAGCTCTTTCCTGCCGCTG
GCGGAGTTCGCCATCAACAATGCGAGTCACGCGTCCACGGGCTTGACCCCGTTCTTCGTCAACAACACGCGTCACCCGCGCGTTCCCGCGATGATCGGCT
TGACAACGCCTTCGGACGATATTGGCTCCACTCTTGGTGGGGGAGAAGATAAGGCTACGCCGACGCTGTCGGCGCTATTGCCGAGTGAAGACGATAACGG
GTTGGCGCTGGTACCTGGTACCAGTGCCGAAGCGGTGAACAGCATCGCGTCGAGAACTCGATCGAAGGCTGCTACTCTATTGGCTATGGACACGGCGGAC
GTGACGGGTGGCGTCACGTCATCCGTGGCAAACTTCGCCCCAAACGAAGGTGCTACCCCGATCAGCTCCGCAGCTGTATCGGAGTTCATGCTTCAGCGTC
AAGCCGTCACGCGATTCGTGCGTGACGCGCTGCATGCAGCCGTGGACAAGCAGAAAGAGAATGCCGATAAAAGAGGTCGGAAGAACACGGTTGTCTTCAG
ACGTGGCGACCGCGTATTATTATCGACCACCGGAATTCAATCATCGGCAGTGACGAACTTGGGCGCAAACAAATTAGCACCAAGATTTATTGGTCCATTC
AAGATTATGCGAGCTCATGGAGACGCCTACACGCTA